ID: 1156010543

View in Genome Browser
Species Human (GRCh38)
Location 18:32492580-32492602
Sequence GAAGATACCCATTTTTAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156010543_1156010549 20 Left 1156010543 18:32492580-32492602 CCCATTTAAAAATGGGTATCTTC No data
Right 1156010549 18:32492623-32492645 ACAATGCACCTGAAATAAATTGG No data
1156010543_1156010545 -4 Left 1156010543 18:32492580-32492602 CCCATTTAAAAATGGGTATCTTC No data
Right 1156010545 18:32492599-32492621 CTTCTGTCCATCCCTTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156010543 Original CRISPR GAAGATACCCATTTTTAAAT GGG (reversed) Intergenic
No off target data available for this crispr