ID: 1156012641

View in Genome Browser
Species Human (GRCh38)
Location 18:32512471-32512493
Sequence CCTCAAGTCGTGCAGATGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156012632_1156012641 -6 Left 1156012632 18:32512454-32512476 CCCCTGGTCCACCCCCTCCTCAA 0: 1
1: 1
2: 0
3: 19
4: 320
Right 1156012641 18:32512471-32512493 CCTCAAGTCGTGCAGATGTATGG No data
1156012626_1156012641 19 Left 1156012626 18:32512429-32512451 CCTGGCAGAAAACCTCTTGGCCC 0: 1
1: 1
2: 2
3: 12
4: 127
Right 1156012641 18:32512471-32512493 CCTCAAGTCGTGCAGATGTATGG No data
1156012634_1156012641 -8 Left 1156012634 18:32512456-32512478 CCTGGTCCACCCCCTCCTCAAGT 0: 1
1: 1
2: 3
3: 26
4: 301
Right 1156012641 18:32512471-32512493 CCTCAAGTCGTGCAGATGTATGG No data
1156012629_1156012641 -1 Left 1156012629 18:32512449-32512471 CCCTCCCCCTGGTCCACCCCCTC 0: 1
1: 1
2: 12
3: 140
4: 1535
Right 1156012641 18:32512471-32512493 CCTCAAGTCGTGCAGATGTATGG No data
1156012624_1156012641 22 Left 1156012624 18:32512426-32512448 CCTCCTGGCAGAAAACCTCTTGG 0: 1
1: 1
2: 2
3: 14
4: 124
Right 1156012641 18:32512471-32512493 CCTCAAGTCGTGCAGATGTATGG No data
1156012631_1156012641 -5 Left 1156012631 18:32512453-32512475 CCCCCTGGTCCACCCCCTCCTCA 0: 1
1: 1
2: 8
3: 101
4: 1227
Right 1156012641 18:32512471-32512493 CCTCAAGTCGTGCAGATGTATGG No data
1156012630_1156012641 -2 Left 1156012630 18:32512450-32512472 CCTCCCCCTGGTCCACCCCCTCC 0: 1
1: 1
2: 12
3: 211
4: 2389
Right 1156012641 18:32512471-32512493 CCTCAAGTCGTGCAGATGTATGG No data
1156012633_1156012641 -7 Left 1156012633 18:32512455-32512477 CCCTGGTCCACCCCCTCCTCAAG 0: 1
1: 1
2: 0
3: 21
4: 270
Right 1156012641 18:32512471-32512493 CCTCAAGTCGTGCAGATGTATGG No data
1156012628_1156012641 7 Left 1156012628 18:32512441-32512463 CCTCTTGGCCCTCCCCCTGGTCC 0: 1
1: 1
2: 3
3: 42
4: 493
Right 1156012641 18:32512471-32512493 CCTCAAGTCGTGCAGATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156012641 Original CRISPR CCTCAAGTCGTGCAGATGTA TGG Intergenic
No off target data available for this crispr