ID: 1156013162

View in Genome Browser
Species Human (GRCh38)
Location 18:32517209-32517231
Sequence ACAATGAGGATGAATGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156013162_1156013166 20 Left 1156013162 18:32517209-32517231 CCTGGTTCATTCATCCTCATTGT No data
Right 1156013166 18:32517252-32517274 GGATTCTGTTTTGCTGTAATTGG No data
1156013162_1156013164 -1 Left 1156013162 18:32517209-32517231 CCTGGTTCATTCATCCTCATTGT No data
Right 1156013164 18:32517231-32517253 TCTTTGTTCTAATGCACCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156013162 Original CRISPR ACAATGAGGATGAATGAACC AGG (reversed) Intergenic
No off target data available for this crispr