ID: 1156013163

View in Genome Browser
Species Human (GRCh38)
Location 18:32517223-32517245
Sequence GCATTAGAACAAAGACAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156013163_1156013168 30 Left 1156013163 18:32517223-32517245 CCTCATTGTCTTTGTTCTAATGC No data
Right 1156013168 18:32517276-32517298 CTTTAGTCAAAGTCTCGCAGAGG No data
1156013163_1156013166 6 Left 1156013163 18:32517223-32517245 CCTCATTGTCTTTGTTCTAATGC No data
Right 1156013166 18:32517252-32517274 GGATTCTGTTTTGCTGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156013163 Original CRISPR GCATTAGAACAAAGACAATG AGG (reversed) Intergenic
No off target data available for this crispr