ID: 1156013166

View in Genome Browser
Species Human (GRCh38)
Location 18:32517252-32517274
Sequence GGATTCTGTTTTGCTGTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156013162_1156013166 20 Left 1156013162 18:32517209-32517231 CCTGGTTCATTCATCCTCATTGT No data
Right 1156013166 18:32517252-32517274 GGATTCTGTTTTGCTGTAATTGG No data
1156013163_1156013166 6 Left 1156013163 18:32517223-32517245 CCTCATTGTCTTTGTTCTAATGC No data
Right 1156013166 18:32517252-32517274 GGATTCTGTTTTGCTGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156013166 Original CRISPR GGATTCTGTTTTGCTGTAAT TGG Intergenic
No off target data available for this crispr