ID: 1156022941

View in Genome Browser
Species Human (GRCh38)
Location 18:32620468-32620490
Sequence GGTTGAGGATGTTGCTGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156022934_1156022941 27 Left 1156022934 18:32620418-32620440 CCGGGAGACTGTTTTCACATGCT No data
Right 1156022941 18:32620468-32620490 GGTTGAGGATGTTGCTGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156022941 Original CRISPR GGTTGAGGATGTTGCTGTAA GGG Intergenic
No off target data available for this crispr