ID: 1156023008

View in Genome Browser
Species Human (GRCh38)
Location 18:32620923-32620945
Sequence CTTTATTAGCAGAATGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156023006_1156023008 -6 Left 1156023006 18:32620906-32620928 CCCAGTCTCAGGTGTGTCTTTAT 0: 117
1: 3092
2: 6466
3: 10755
4: 11358
Right 1156023008 18:32620923-32620945 CTTTATTAGCAGAATGAGAATGG No data
1156023007_1156023008 -7 Left 1156023007 18:32620907-32620929 CCAGTCTCAGGTGTGTCTTTATT 0: 42
1: 1277
2: 3942
3: 7410
4: 10896
Right 1156023008 18:32620923-32620945 CTTTATTAGCAGAATGAGAATGG No data
1156023004_1156023008 14 Left 1156023004 18:32620886-32620908 CCTCTTTTCTTTATAAATTACCC 0: 3806
1: 9545
2: 9195
3: 5640
4: 5267
Right 1156023008 18:32620923-32620945 CTTTATTAGCAGAATGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156023008 Original CRISPR CTTTATTAGCAGAATGAGAA TGG Intergenic
No off target data available for this crispr