ID: 1156023622

View in Genome Browser
Species Human (GRCh38)
Location 18:32627439-32627461
Sequence TGGTGCTATTGCAAGAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156023622_1156023630 26 Left 1156023622 18:32627439-32627461 CCATTGTTCTTGCAATAGCACCA No data
Right 1156023630 18:32627488-32627510 CCACTGTTACCCGTGGGAGGAGG No data
1156023622_1156023626 19 Left 1156023622 18:32627439-32627461 CCATTGTTCTTGCAATAGCACCA No data
Right 1156023626 18:32627481-32627503 TTTTGTTCCACTGTTACCCGTGG No data
1156023622_1156023628 23 Left 1156023622 18:32627439-32627461 CCATTGTTCTTGCAATAGCACCA No data
Right 1156023628 18:32627485-32627507 GTTCCACTGTTACCCGTGGGAGG No data
1156023622_1156023627 20 Left 1156023622 18:32627439-32627461 CCATTGTTCTTGCAATAGCACCA No data
Right 1156023627 18:32627482-32627504 TTTGTTCCACTGTTACCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156023622 Original CRISPR TGGTGCTATTGCAAGAACAA TGG (reversed) Intergenic
No off target data available for this crispr