ID: 1156023623

View in Genome Browser
Species Human (GRCh38)
Location 18:32627459-32627481
Sequence AGAAGAAGTGGAATTGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156023623_1156023627 0 Left 1156023623 18:32627459-32627481 CCACTTCCAATTCCACTTCTTCT No data
Right 1156023627 18:32627482-32627504 TTTGTTCCACTGTTACCCGTGGG No data
1156023623_1156023626 -1 Left 1156023623 18:32627459-32627481 CCACTTCCAATTCCACTTCTTCT No data
Right 1156023626 18:32627481-32627503 TTTTGTTCCACTGTTACCCGTGG No data
1156023623_1156023630 6 Left 1156023623 18:32627459-32627481 CCACTTCCAATTCCACTTCTTCT No data
Right 1156023630 18:32627488-32627510 CCACTGTTACCCGTGGGAGGAGG No data
1156023623_1156023628 3 Left 1156023623 18:32627459-32627481 CCACTTCCAATTCCACTTCTTCT No data
Right 1156023628 18:32627485-32627507 GTTCCACTGTTACCCGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156023623 Original CRISPR AGAAGAAGTGGAATTGGAAG TGG (reversed) Intergenic
No off target data available for this crispr