ID: 1156023630

View in Genome Browser
Species Human (GRCh38)
Location 18:32627488-32627510
Sequence CCACTGTTACCCGTGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156023624_1156023630 0 Left 1156023624 18:32627465-32627487 CCAATTCCACTTCTTCTTTTGTT No data
Right 1156023630 18:32627488-32627510 CCACTGTTACCCGTGGGAGGAGG No data
1156023625_1156023630 -6 Left 1156023625 18:32627471-32627493 CCACTTCTTCTTTTGTTCCACTG No data
Right 1156023630 18:32627488-32627510 CCACTGTTACCCGTGGGAGGAGG No data
1156023623_1156023630 6 Left 1156023623 18:32627459-32627481 CCACTTCCAATTCCACTTCTTCT No data
Right 1156023630 18:32627488-32627510 CCACTGTTACCCGTGGGAGGAGG No data
1156023622_1156023630 26 Left 1156023622 18:32627439-32627461 CCATTGTTCTTGCAATAGCACCA No data
Right 1156023630 18:32627488-32627510 CCACTGTTACCCGTGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156023630 Original CRISPR CCACTGTTACCCGTGGGAGG AGG Intergenic
No off target data available for this crispr