ID: 1156026619

View in Genome Browser
Species Human (GRCh38)
Location 18:32662195-32662217
Sequence CTCTGACACAAATGCAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156026619_1156026626 29 Left 1156026619 18:32662195-32662217 CCATCACTGCATTTGTGTCAGAG No data
Right 1156026626 18:32662247-32662269 AGCCAGTGATTAAATGTGTCAGG No data
1156026619_1156026627 30 Left 1156026619 18:32662195-32662217 CCATCACTGCATTTGTGTCAGAG No data
Right 1156026627 18:32662248-32662270 GCCAGTGATTAAATGTGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156026619 Original CRISPR CTCTGACACAAATGCAGTGA TGG (reversed) Intergenic
No off target data available for this crispr