ID: 1156026622

View in Genome Browser
Species Human (GRCh38)
Location 18:32662227-32662249
Sequence GCTTGGCTGGGAGTAGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156026622_1156026626 -3 Left 1156026622 18:32662227-32662249 CCACAGACTACTCCCAGCCAAGC No data
Right 1156026626 18:32662247-32662269 AGCCAGTGATTAAATGTGTCAGG No data
1156026622_1156026627 -2 Left 1156026622 18:32662227-32662249 CCACAGACTACTCCCAGCCAAGC No data
Right 1156026627 18:32662248-32662270 GCCAGTGATTAAATGTGTCAGGG No data
1156026622_1156026630 27 Left 1156026622 18:32662227-32662249 CCACAGACTACTCCCAGCCAAGC No data
Right 1156026630 18:32662277-32662299 AGACAGGCCTATTTCTACCATGG No data
1156026622_1156026629 11 Left 1156026622 18:32662227-32662249 CCACAGACTACTCCCAGCCAAGC No data
Right 1156026629 18:32662261-32662283 TGTGTCAGGGATACTAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156026622 Original CRISPR GCTTGGCTGGGAGTAGTCTG TGG (reversed) Intergenic
No off target data available for this crispr