ID: 1156026627

View in Genome Browser
Species Human (GRCh38)
Location 18:32662248-32662270
Sequence GCCAGTGATTAAATGTGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156026621_1156026627 -1 Left 1156026621 18:32662226-32662248 CCCACAGACTACTCCCAGCCAAG No data
Right 1156026627 18:32662248-32662270 GCCAGTGATTAAATGTGTCAGGG No data
1156026620_1156026627 7 Left 1156026620 18:32662218-32662240 CCACATTTCCCACAGACTACTCC No data
Right 1156026627 18:32662248-32662270 GCCAGTGATTAAATGTGTCAGGG No data
1156026619_1156026627 30 Left 1156026619 18:32662195-32662217 CCATCACTGCATTTGTGTCAGAG No data
Right 1156026627 18:32662248-32662270 GCCAGTGATTAAATGTGTCAGGG No data
1156026622_1156026627 -2 Left 1156026622 18:32662227-32662249 CCACAGACTACTCCCAGCCAAGC No data
Right 1156026627 18:32662248-32662270 GCCAGTGATTAAATGTGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156026627 Original CRISPR GCCAGTGATTAAATGTGTCA GGG Intergenic
No off target data available for this crispr