ID: 1156028770

View in Genome Browser
Species Human (GRCh38)
Location 18:32688825-32688847
Sequence TAGGAGGGCCACTGTGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156028765_1156028770 16 Left 1156028765 18:32688786-32688808 CCAATCTATCATGCTGGCTGCTG 0: 1
1: 0
2: 0
3: 16
4: 168
Right 1156028770 18:32688825-32688847 TAGGAGGGCCACTGTGGAAGAGG 0: 1
1: 0
2: 1
3: 25
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156028770 Original CRISPR TAGGAGGGCCACTGTGGAAG AGG Intronic
900420668 1:2554675-2554697 TAGGAGGGGCATGGAGGAAGGGG + Intergenic
900585897 1:3432207-3432229 TAGGAGGGCCACGGCGGGAGAGG - Intronic
900717835 1:4156615-4156637 TGGGGGTGCCACTGTGGAATGGG - Intergenic
902057585 1:13615092-13615114 TAGGAGTTCCACTGAGGATGGGG + Intronic
902139301 1:14338913-14338935 TAGGAGAGCCATGATGGAAGGGG + Intergenic
903600610 1:24535994-24536016 AAGGACGGCCACTTTAGAAGTGG + Exonic
904467176 1:30715099-30715121 CAGGTGGGGCACTGTGGAGGTGG - Intronic
904896758 1:33823513-33823535 TGGGAGGGCCACTATGGCAAGGG + Intronic
905537004 1:38729999-38730021 TACCAGGGCTTCTGTGGAAGCGG - Intergenic
906191252 1:43900835-43900857 TAGGTGGGACAGTGGGGAAGGGG + Intronic
907476683 1:54710514-54710536 TTGGATGGCCACTGGGGAAAGGG + Intronic
908690662 1:66775840-66775862 CAAGAGGGGCACTGTGGTAGCGG + Intronic
908922543 1:69212818-69212840 TAAGAGGGGCACTGTTGGAGAGG + Intergenic
911701116 1:100952770-100952792 TAGGAGGGACACTGCAGAAAAGG - Intronic
912449618 1:109761033-109761055 TGAGAGGGCCACTGTTGGAGAGG - Intronic
918357294 1:183717215-183717237 GAGAAGGGCAACTGTGAAAGAGG - Intronic
920215400 1:204358939-204358961 AAGGAGGGCTACAGTGGAAGGGG - Intronic
921185552 1:212666580-212666602 AAGGGGGGCCAGGGTGGAAGGGG + Intergenic
922215908 1:223519902-223519924 TAGGAGGGACAGTGTGGCAAAGG - Intergenic
922218422 1:223539563-223539585 TGGGAGGGCAACAGAGGAAGAGG + Intronic
922784445 1:228276129-228276151 GAGGAGGGGCACTGAGGAAGAGG + Intronic
924163760 1:241261183-241261205 TAGGACAGGCACTGGGGAAGAGG + Intronic
1066065143 10:31756350-31756372 AAGGAGGGCAAGGGTGGAAGTGG + Intergenic
1066816487 10:39423513-39423535 TTGGAGGCCAACTGTGGAAAAGG - Intergenic
1067144590 10:43685858-43685880 TAGCAGGGCGACTGTGGCTGTGG + Intergenic
1067256503 10:44647537-44647559 GTGGAGGGGCACTGGGGAAGAGG - Intergenic
1068380743 10:56250901-56250923 TAGGTGAACCATTGTGGAAGAGG - Intergenic
1069774172 10:70917264-70917286 GAGGAGGGCCAATCTGGGAGCGG - Intergenic
1069857226 10:71448025-71448047 CAGGTGGGCCACTGAGGCAGTGG + Intronic
1070550076 10:77483994-77484016 TAGGAGGACCAGGGTGGGAGGGG + Intronic
1070686554 10:78488882-78488904 GAGGAGGGCGTCTGTGCAAGGGG + Intergenic
1073106610 10:101035953-101035975 GATGAGGGCCACTGTAGACGGGG + Intronic
1073207707 10:101777343-101777365 ATGGAGGGTCACTGGGGAAGGGG - Intronic
1073315849 10:102580293-102580315 CAGGAGGTCCACTGTTAAAGGGG + Intronic
1074210894 10:111334012-111334034 TAGGATGGCCACTGTGGAGATGG + Intergenic
1076275693 10:129196634-129196656 AAGGAGGTCCCCTGGGGAAGAGG - Intergenic
1076331969 10:129676494-129676516 TGCGAGGGTCCCTGTGGAAGTGG + Intronic
1077420170 11:2446301-2446323 AAGTAGGGCCACTGGGGCAGCGG - Intronic
1081056256 11:38413720-38413742 AAAGAGGGCAACTTTGGAAGTGG + Intergenic
1082319406 11:50781303-50781325 TTGGAGGCCTACTGTGGTAGAGG - Intergenic
1083104591 11:60345795-60345817 CAGTAGGGCCACTGTGGCAATGG + Intronic
1084404289 11:68962053-68962075 CAGGAGGGTCAGCGTGGAAGTGG + Intergenic
1084580304 11:70019149-70019171 TAAGCAGGCCTCTGTGGAAGGGG + Intergenic
1086749353 11:90471604-90471626 TAAGAGGGTCACTGGGGACGTGG + Intergenic
1088051502 11:105520844-105520866 TAGGAGAGCCACTCTGAAACAGG + Intergenic
1092578787 12:9817673-9817695 TAGTGGAGCCACTGAGGAAGAGG - Intergenic
1092973808 12:13724739-13724761 TAGGAGAGTGAATGTGGAAGGGG - Intronic
1094510605 12:31094148-31094170 TTGGAAGGCGTCTGTGGAAGTGG + Intronic
1095061215 12:37692464-37692486 TTGGAGGCCTACTGTGGAAAAGG - Intergenic
1095061401 12:37696075-37696097 TAGGAGGCCTATTGTGGAAAAGG - Intergenic
1097831502 12:64229363-64229385 TGAAAGAGCCACTGTGGAAGGGG - Intergenic
1100235984 12:92661417-92661439 TCATAGCGCCACTGTGGAAGTGG + Intergenic
1101739657 12:107491084-107491106 TAGGTGGGCCTCTGTGGCTGAGG + Intronic
1104482874 12:129123835-129123857 CAGGAGGGGCACTGTTCAAGGGG - Intronic
1105491321 13:20891195-20891217 TAAGGGAGCCACTGTGGTAGTGG - Intronic
1106755865 13:32822081-32822103 TTTGAGGGCCACTGTTGAAAGGG - Intergenic
1107690523 13:42948350-42948372 TGGGAGGGCCATAGGGGAAGTGG + Intronic
1110131760 13:72019562-72019584 TAGGAGGGCCCCTGTGGGTGGGG - Intergenic
1115766311 14:36626765-36626787 CAGGAGAGCCAGTTTGGAAGTGG - Intergenic
1116371027 14:44132706-44132728 TAGGAGAGTCAATGTGAAAGTGG - Intergenic
1116986793 14:51228511-51228533 TATGAGATCCACTTTGGAAGTGG + Intergenic
1118604840 14:67495252-67495274 AAGGAGGGCCAAATTGGAAGAGG - Intronic
1118703702 14:68460523-68460545 TAGGAAGGCCAGTGTGGAGCAGG - Intronic
1119226168 14:72946096-72946118 GAGGAGAGCAACTGGGGAAGAGG + Intronic
1119567815 14:75643728-75643750 TAGTATGGCCACTGTGGAGATGG + Intronic
1119771479 14:77222703-77222725 GAGAAGGGCCACTGCGGAAGGGG - Intronic
1122365652 14:101193509-101193531 AATGAGGGCCACTATGGCAGTGG - Intergenic
1122366389 14:101197305-101197327 TGGGAGGGCCAGTGAGGATGGGG - Intergenic
1122748119 14:103911864-103911886 TAGGAGAGCAGCTGTGGAATGGG - Intergenic
1124179934 15:27463609-27463631 TAGGGAGGCCACTGGGAAAGGGG - Intronic
1126180766 15:45782931-45782953 TAGAAGTACCACTGAGGAAGTGG - Intergenic
1130025366 15:80266517-80266539 TAGGAAGATCACTGTGGGAGTGG - Intergenic
1132073516 15:98800201-98800223 TGGGAGGGCAGCTGTGGAAAAGG + Intronic
1132556584 16:575348-575370 GATGAGGTCCCCTGTGGAAGGGG - Intronic
1135330812 16:21558229-21558251 CGGGAGGGCCCCCGTGGAAGCGG + Intergenic
1135435392 16:22423471-22423493 TAGGAGCGGGACTGAGGAAGGGG - Intronic
1136144760 16:28310055-28310077 TGGGAGGGCCACCGTGGTGGGGG - Intronic
1136751364 16:32638311-32638333 GAGCTGGGCCTCTGTGGAAGGGG + Intergenic
1136915707 16:34194314-34194336 TTAGAGGACCACTGTGGAATAGG - Intergenic
1142008602 16:87702228-87702250 TGGCAGAGCCACTGTGGAGGAGG - Intronic
1142043840 16:87912723-87912745 CAGGAGGGCCCCCGTGGAAGCGG + Intronic
1142044589 16:87917280-87917302 TAGGAGCGGGACTGAGGAAGAGG - Intronic
1203053498 16_KI270728v1_random:897566-897588 GAGCTGGGCCTCTGTGGAAGGGG + Intergenic
1143334660 17:6163205-6163227 TAGGAGGGCAACCGTGGCAAGGG + Intergenic
1143502301 17:7346619-7346641 CTGGGGGGCCATTGTGGAAGAGG + Intronic
1143780047 17:9224599-9224621 AAGGAAGGCTGCTGTGGAAGGGG - Intronic
1144364530 17:14529441-14529463 TAAGAGGTCAACTGTGGCAGGGG - Intergenic
1144620431 17:16815286-16815308 GACGAGGGCCAATGTGGCAGGGG - Intergenic
1144890059 17:18489348-18489370 TAAGAAGGTCACTGTGGCAGCGG - Intronic
1145142157 17:20454969-20454991 TAAGAAGGTCACTGTGGCAGCGG + Intronic
1145793753 17:27643933-27643955 TAAGAAGGTCACTGTGGCAGTGG - Intronic
1146017646 17:29246835-29246857 GAGGAGGGCCACAGAGCAAGTGG + Intergenic
1147337555 17:39736806-39736828 TAAGAGGTCCACCCTGGAAGGGG - Intergenic
1147422354 17:40328174-40328196 TGCCAAGGCCACTGTGGAAGAGG - Intronic
1147571811 17:41576159-41576181 GAGGAGGGCCAATGTGGCAGGGG - Intergenic
1149803690 17:59594452-59594474 TAGGAGAGCCACTGAAGAACAGG - Intronic
1149842801 17:59981032-59981054 TAGGAGAGCCACTGAAGAACAGG + Intergenic
1152115108 17:78381164-78381186 TGGGAGGGGCAGTGTGGCAGTGG + Intronic
1152354321 17:79799323-79799345 CTCCAGGGCCACTGTGGAAGTGG + Intronic
1152788660 17:82266068-82266090 CAGAAGGGCCACTGTGGAGAGGG - Intronic
1152811062 17:82383057-82383079 TAGGAGGGACACGGTGCCAGGGG + Intergenic
1153688136 18:7567032-7567054 GGGGAGGGTGACTGTGGAAGAGG - Exonic
1156028770 18:32688825-32688847 TAGGAGGGCCACTGTGGAAGAGG + Intronic
1156458388 18:37307492-37307514 TAGCAGGGCCGCTGTGGTGGTGG - Intronic
1157332322 18:46712883-46712905 TAGGAAGGCCACTCTGGACAGGG + Intronic
1158482653 18:57835644-57835666 TGGGAGGGTCACTCTAGAAGAGG + Intergenic
1159242981 18:65767047-65767069 TAGGGAAGCAACTGTGGAAGAGG - Intronic
1159877281 18:73826939-73826961 CAGGAGGGCCAGGGTGGAATTGG + Intergenic
1160261281 18:77296535-77296557 TAGCAGTGCCAATGTGGAAATGG + Intergenic
1160962494 19:1729784-1729806 CAGGAGGGCTCCTGAGGAAGTGG - Intergenic
1162562516 19:11425883-11425905 TAGGGGGGTCACTGAGTAAGGGG + Intronic
1164348938 19:27308025-27308047 TATGAGGCCTACTGTGGAAAAGG + Intergenic
1164349268 19:27314498-27314520 TTGGAGGGCAATTGTGGAAAAGG + Intergenic
1164349318 19:27315534-27315556 TAGGAGGCCTATTGTGGAAACGG + Intergenic
1164888126 19:31800702-31800724 TATGAGGTCCTCTGTGGAGGAGG - Intergenic
1166720494 19:44993256-44993278 TAGGAGGGGGAGTGTGGTAGGGG - Exonic
1166735571 19:45082214-45082236 TAGCAAGGCCAGTGTGGAGGAGG - Intronic
1166889511 19:45981877-45981899 AGGGTGGGCCAGTGTGGAAGTGG - Intergenic
1167041970 19:47027845-47027867 TGGGAGGGCGGATGTGGAAGTGG + Intronic
926104604 2:10142408-10142430 AAGAGGGGCCACTGTGGAGGTGG + Intronic
926304598 2:11628854-11628876 TCTGGGGGCCACAGTGGAAGAGG + Intronic
927393839 2:22626895-22626917 GAGGAGGTCAACTTTGGAAGGGG - Intergenic
927702500 2:25277064-25277086 CAGGAGGGCCACCGTGGGTGCGG + Intronic
929007661 2:37411497-37411519 TAGGAGAGCCACTCTAGAGGTGG + Intergenic
929050582 2:37833441-37833463 TAAAATGGCCACTGTGGAAATGG + Intergenic
929610962 2:43270304-43270326 TAGGAGGGGCACTGGAGAACAGG + Intronic
929902877 2:46021059-46021081 GAGAAGGGCCACTGTGGAACAGG + Intronic
929995223 2:46821750-46821772 AAGGAGGGACACTGGGGAGGAGG - Intronic
932623015 2:73277213-73277235 ATGGAGGGCAACTGTGGAGGAGG - Intronic
936961331 2:118078046-118078068 TAGAAGGGCAACTGTGGAAATGG - Intergenic
937908529 2:127064384-127064406 GAGGAGGTTCATTGTGGAAGTGG - Intronic
937974518 2:127574150-127574172 TGGGAGGGCCCTTGGGGAAGAGG - Intronic
939464563 2:142540944-142540966 TTGTAGGGCCACCGTGGAACGGG + Intergenic
940146574 2:150551456-150551478 TAGGAAGCCCACAGTGGCAGGGG + Intergenic
942292406 2:174486345-174486367 TGGGAAGGCAGCTGTGGAAGTGG + Intronic
943791741 2:191940748-191940770 TAGGAAGGCTTCTGTGGGAGAGG - Intergenic
947652931 2:231802630-231802652 TTGAAGGGTGACTGTGGAAGAGG + Intronic
948022193 2:234743793-234743815 TCAGAAGGCCACTGTGGAAGAGG - Intergenic
948341533 2:237256600-237256622 TGGGAGGGAGACGGTGGAAGTGG - Intergenic
948468897 2:238165044-238165066 TGGGAGGGCGACTGAGGAGGGGG - Intronic
948561487 2:238856732-238856754 TCTGAGGGACACTGAGGAAGAGG - Intronic
948967151 2:241391736-241391758 TAGGAGGACCACTGTGGATTTGG + Intronic
1169994690 20:11543975-11543997 TAGGAGGGTAAGTTTGGAAGGGG - Intergenic
1170566870 20:17612521-17612543 TAGGAAGGCCCCTGGAGAAGTGG - Intergenic
1172046315 20:32083156-32083178 TAGGAAGGTCAAAGTGGAAGAGG - Intronic
1172745732 20:37207202-37207224 TGGGAGGGCCACTGCTGTAGAGG - Intronic
1174426528 20:50435535-50435557 CGGGAGGGCCTCTGAGGAAGTGG + Intergenic
1175252547 20:57618183-57618205 TGGGAGAGCCACTGTGGGCGGGG + Intronic
1175603700 20:60295647-60295669 TAGGAAGGCTACTGAGGCAGGGG + Intergenic
1176428734 21:6563708-6563730 CAGGGGGGCCACTGTGCAGGCGG - Intergenic
1179293674 21:40042095-40042117 TCGGTGAGCCACTTTGGAAGTGG + Intronic
1179704224 21:43172024-43172046 CAGGGGGGCCACTGTGCAGGCGG - Intronic
1180325006 22:11362947-11362969 TTGGAGGCTTACTGTGGAAGTGG + Intergenic
1182824664 22:33254368-33254390 TAGTAGGCCCATTGTTGAAGAGG + Intronic
1183091479 22:35525265-35525287 CAGGAGCCCCACTGTGGCAGAGG - Intergenic
1183341686 22:37285033-37285055 TAGGAGGGACCCTGGGGCAGAGG - Intronic
1183661493 22:39224139-39224161 TAGGAGGGAGACTGTGGTAGGGG - Exonic
1183752029 22:39726638-39726660 TAGGAAGGCCACTCAGGCAGGGG - Intergenic
1184994448 22:48195170-48195192 AAGGAGAGGCCCTGTGGAAGAGG - Intergenic
949152701 3:789734-789756 TGGGACGGCCAACGTGGAAGAGG + Intergenic
952585077 3:34882704-34882726 TTTGAGGGCCAGTGTGAAAGGGG - Intergenic
952622516 3:35362562-35362584 TAGGAGGACAGCTGTGGAGGAGG + Intergenic
955421492 3:58742703-58742725 AAGGAAGAGCACTGTGGAAGTGG + Intronic
955502572 3:59599626-59599648 TAGAATGGCTCCTGTGGAAGGGG - Intergenic
956706498 3:72003623-72003645 CAGGAAGGCCACTGTTGATGGGG + Intergenic
956848990 3:73211046-73211068 AAAGAGGGTGACTGTGGAAGAGG + Intergenic
958684365 3:97374213-97374235 TAGGATAGCAACTGTGGATGTGG - Intronic
963260133 3:143184147-143184169 CAGGAGGGCCAACTTGGAAGGGG - Intergenic
965873933 3:173294356-173294378 TAGTACAACCACTGTGGAAGTGG - Intergenic
967855626 3:194115322-194115344 TGGAAGGGCCATTGTGGCAGTGG - Intergenic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
969449050 4:7262660-7262682 AAGGAGGGCCTCTGAGGAGGGGG + Intronic
970168756 4:13267293-13267315 AAGGAGAGCCACTCTGGGAGTGG - Intergenic
970190757 4:13514388-13514410 TTGGCGGACCATTGTGGAAGAGG - Intergenic
972639045 4:40909083-40909105 GAGCAGGGCCACTGTGACAGGGG - Intronic
972812916 4:42610011-42610033 TATGAGCGTTACTGTGGAAGTGG - Intronic
973606976 4:52597543-52597565 TTAGTGGGCCACTGGGGAAGAGG + Exonic
975183455 4:71373774-71373796 TAGGATTGCGACTGTGGAAGTGG + Intronic
975870080 4:78770467-78770489 TATGAAGGTCACTGTGGCAGTGG + Intergenic
978618284 4:110616390-110616412 TAGGAGGGTCGTTGTGGAGGTGG - Intergenic
979224895 4:118273595-118273617 TGGGAGGGACACTGTAGCAGAGG - Intergenic
981018671 4:140002841-140002863 TACAAGGGTCACTGTGTAAGTGG - Intronic
983010188 4:162537366-162537388 TGGGAGGGGGACTGAGGAAGGGG + Intergenic
983064382 4:163192285-163192307 TAGCAGAGCCACTGTGGCAGTGG + Intergenic
983488599 4:168361655-168361677 TAGGAGAGACAGTGTGGCAGAGG - Intronic
986096204 5:4556093-4556115 GAGGAGGGCCACTGTGCCACGGG - Intergenic
986442296 5:7793029-7793051 CAGCAGGGCCACAGGGGAAGTGG - Intronic
991622117 5:68555790-68555812 AAGGAGGGCCCATGTGGAGGTGG + Intergenic
994158392 5:96528404-96528426 TAGGAGGGGCCCAGTGGAAGGGG - Intronic
998399990 5:141843621-141843643 TGGGAGGGACAATGGGGAAGAGG - Intergenic
998671428 5:144358568-144358590 TAACAGGGCCAATGGGGAAGAGG - Intronic
1000810188 5:165851915-165851937 TAGAAGGAACACTGTGGTAGTGG - Intergenic
1002298397 5:178243957-178243979 TGGGAGAGCAACTGTGGACGAGG - Intronic
1002442465 5:179271522-179271544 TAGGAGGGCCAGCGTGGAAGGGG - Intronic
1004514590 6:16311684-16311706 TAGGAGGACCAATCTGGAACTGG + Intronic
1005169123 6:22961321-22961343 GAGGAGGGCGACTGTGGCATTGG + Intergenic
1006419565 6:33924781-33924803 TTGGAGGGCCCCTGGGGCAGTGG - Intergenic
1006515098 6:34541315-34541337 CCTGAGGGCCCCTGTGGAAGTGG + Intronic
1008632398 6:53375015-53375037 TAGGAAGGTTACTGTGGCAGGGG + Intergenic
1011549447 6:88516222-88516244 TTGGAGGGCCCCTGAGGGAGTGG - Intergenic
1011618274 6:89217890-89217912 TGGGAGGGCAACTGGGGAAGAGG + Intronic
1012366256 6:98444247-98444269 TAGGTTGGCAACTGTGGAGGAGG - Intergenic
1016690391 6:146930980-146931002 AAGGAGGGGCACTGGGGCAGAGG - Intergenic
1017441842 6:154471856-154471878 TATGATGGCCACTATGGAACTGG - Intronic
1017826663 6:158086760-158086782 CAGGAGGCCGACTGTGGCAGGGG - Intronic
1022281804 7:28918537-28918559 TGGGAGGGGGACTGGGGAAGAGG + Intergenic
1024812066 7:53223612-53223634 CAGGAGGGACACTGTGGGGGTGG - Intergenic
1025570963 7:62566096-62566118 TTGGAGGCCTACTGTGGAAAAGG - Intergenic
1025994400 7:66518868-66518890 TTGGAGGGCCAGGCTGGAAGTGG + Intergenic
1026033598 7:66815795-66815817 TTGGAGGGCCAGGCTGGAAGTGG - Intergenic
1026986011 7:74555557-74555579 TTGGAGGGCCAGGCTGGAAGTGG + Intronic
1028241257 7:88423848-88423870 AAGGATGGTCACTGTGGAAGTGG + Intergenic
1030630356 7:111888734-111888756 TTTGAGGGCCAGTGAGGAAGAGG - Intronic
1033021634 7:137731034-137731056 CAGGAGGGCCATTGTGGCTGAGG - Intronic
1033387179 7:140889023-140889045 ATGGAGGGCCACTGTAAAAGTGG - Intronic
1033387372 7:140891578-140891600 ATGGAGGGCCACTGTAGAAGTGG + Intronic
1034311231 7:150090616-150090638 TAGGAGGGAGTCGGTGGAAGAGG - Intergenic
1034329493 7:150270079-150270101 AAAGAGGGCCACTGGGGAAGTGG + Intronic
1034527465 7:151674679-151674701 TAGGATGCCCTCTTTGGAAGGGG - Intronic
1034668563 7:152839782-152839804 AAAGAGGGCCACTGGGGAAGTGG - Intronic
1034795624 7:154010027-154010049 TAGGAGGGAGTCGGTGGAAGAGG + Intronic
1037606251 8:20439872-20439894 TACTAGAGTCACTGTGGAAGAGG - Intergenic
1041153484 8:54960411-54960433 TAGAAGGGTGACTGTGGAATGGG - Intergenic
1041959339 8:63594582-63594604 TAGGATGGCAAGGGTGGAAGCGG + Intergenic
1043120598 8:76318192-76318214 ACTGAGGTCCACTGTGGAAGTGG + Intergenic
1046951132 8:120020637-120020659 CAGGAGGGCTGCTGTCGAAGAGG + Intronic
1047133478 8:122049807-122049829 AAGGAGGGCTAGAGTGGAAGAGG - Intergenic
1047530659 8:125671432-125671454 TAGTACAGCCACTATGGAAGTGG - Intergenic
1047763026 8:127968207-127968229 CAGGAGGGTCACTTTGGAAAAGG - Intergenic
1047813443 8:128435608-128435630 TAGGAGGCCCACTGGGGAAAAGG - Intergenic
1048982047 8:139707693-139707715 CAGGGAGGCCACTGAGGAAGAGG - Intergenic
1053429938 9:38035440-38035462 TAGGGGAGCCAGTGTTGAAGGGG + Intronic
1055657952 9:78471014-78471036 CAGGAGGGCGACTGAGAAAGTGG + Intergenic
1055768488 9:79691106-79691128 CTGGAGGGCTACTGGGGAAGGGG - Intronic
1057293929 9:93824589-93824611 ATGGAGGGCCACTGTGCAAGGGG + Intergenic
1058474808 9:105322101-105322123 CAGGAGGCACACCGTGGAAGTGG + Intronic
1058778917 9:108313647-108313669 CAGGTAGGCCACTGAGGAAGTGG + Intergenic
1059845386 9:118269810-118269832 TAGGATGGCCAAGGTGAAAGTGG - Intergenic
1060207048 9:121688280-121688302 CAGGAGGCCCTCTGTGGAGGTGG + Intronic
1060281447 9:122218474-122218496 TAGGAGGGCAACAGTGGAGATGG - Intronic
1060415104 9:123424541-123424563 ATGCTGGGCCACTGTGGAAGGGG - Intronic
1062681621 9:137785078-137785100 TAGGTGGGGCTCTGAGGAAGAGG + Intronic
1187825635 X:23332507-23332529 TGGGAGGGACACATTGGAAGGGG - Intergenic
1187965204 X:24604966-24604988 TCAGAGGGTCACTGTGTAAGGGG - Intronic
1188361618 X:29261796-29261818 TAGGAAGGCCTCTGTGCAAATGG - Intronic
1188954178 X:36414604-36414626 GAGGAGGGCCAATGAGTAAGGGG + Intergenic
1189093622 X:38114048-38114070 TAGGAAGGGTACTGGGGAAGGGG - Intronic
1189096602 X:38146953-38146975 TGAGTGAGCCACTGTGGAAGCGG + Intronic
1189226731 X:39419482-39419504 TGGGAGGGCCTCTGAGGAAGGGG + Intergenic
1189559131 X:42174759-42174781 TAGGAGCGCATCTTTGGAAGAGG + Intergenic
1190618746 X:52264611-52264633 TGAGAGGGGGACTGTGGAAGTGG + Intergenic
1191039842 X:56067727-56067749 TAGGAGGGGGACGGGGGAAGGGG - Intergenic
1192494286 X:71604620-71604642 TAGTGGAGCCACTGAGGAAGAGG + Exonic
1199769828 X:150967996-150968018 TGGGCGGGGCACTGTGGAGGTGG + Intergenic