ID: 1156030567

View in Genome Browser
Species Human (GRCh38)
Location 18:32707749-32707771
Sequence CACTCTTGGAAGCTTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 1, 2: 4, 3: 39, 4: 319}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156030560_1156030567 26 Left 1156030560 18:32707700-32707722 CCATTCGATGCTGGAAATGAATG 0: 1
1: 0
2: 1
3: 3
4: 88
Right 1156030567 18:32707749-32707771 CACTCTTGGAAGCTTGAGCTGGG 0: 1
1: 1
2: 4
3: 39
4: 319
1156030562_1156030567 0 Left 1156030562 18:32707726-32707748 CCCATGTGACTCCACAGGAGCAG 0: 1
1: 0
2: 1
3: 19
4: 161
Right 1156030567 18:32707749-32707771 CACTCTTGGAAGCTTGAGCTGGG 0: 1
1: 1
2: 4
3: 39
4: 319
1156030563_1156030567 -1 Left 1156030563 18:32707727-32707749 CCATGTGACTCCACAGGAGCAGC 0: 1
1: 0
2: 0
3: 19
4: 204
Right 1156030567 18:32707749-32707771 CACTCTTGGAAGCTTGAGCTGGG 0: 1
1: 1
2: 4
3: 39
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156030567 Original CRISPR CACTCTTGGAAGCTTGAGCT GGG Intronic
900867996 1:5282522-5282544 CACTGTGGGCAGCTTGATCTTGG + Intergenic
901547945 1:9973344-9973366 CACTTTGGGAAGCCTGAGGTTGG - Intronic
901574147 1:10186389-10186411 TCCTCTTGGAAGCTTGCTCTTGG - Intergenic
902113267 1:14100496-14100518 GACTCTTGGAAGCTCAAGCCTGG - Intergenic
903616472 1:24662408-24662430 TACTCTAAGAAGTTTGAGCTGGG - Intronic
904925444 1:34043983-34044005 AACTCTTGGAAGCTTGTGCCTGG + Intronic
906007281 1:42486624-42486646 GACTCTTGGAAGCTTGTTCCTGG + Intronic
906441351 1:45848549-45848571 AACTCTGGGAAGCTTGTGCTTGG + Intronic
908199728 1:61781863-61781885 GACTCGTGGAAGCTTGTGCCTGG - Intronic
910154962 1:84206505-84206527 GACTCTTGAAAGCTTGTGCCTGG - Intronic
910177209 1:84443356-84443378 CAATCTGGGATGCTTGAGCTTGG + Intergenic
910799528 1:91131538-91131560 CAACCTGGGATGCTTGAGCTTGG + Intergenic
911561789 1:99415493-99415515 GACTCTTGGAAGCTTGTACCTGG + Intergenic
911662952 1:100523986-100524008 GACTCGTGGAAGCTGGTGCTTGG - Intergenic
911787514 1:101969411-101969433 CACTCTTGGGAGGCTGAGGTGGG - Intronic
911982752 1:104586662-104586684 CAACCTGGGATGCTTGAGCTTGG + Intergenic
912431232 1:109629545-109629567 CACTCTTGGCACCTTGGGCCAGG + Intronic
915164653 1:153941859-153941881 TACCCTTGGAAGCGTGAGCATGG - Exonic
915593009 1:156881231-156881253 GACTATGGGAAGCTTGGGCTGGG - Intronic
915876522 1:159616661-159616683 CAACCTGGAAAGCTTGAGCTTGG + Intergenic
916476484 1:165174288-165174310 AACTGTTGGCAGCTTGAGATAGG + Intergenic
916731600 1:167571766-167571788 CAATCTGGGATGATTGAGCTTGG - Intergenic
917405971 1:174708959-174708981 CAAGCTGGGATGCTTGAGCTTGG + Intronic
918991948 1:191708188-191708210 GACTCTTAGAAGCTTGTGCCTGG - Intergenic
919468071 1:197946189-197946211 CACTATTGGAAGATTGGGCAGGG + Intergenic
921525160 1:216208782-216208804 AATTCTTGGAAGCTTGTGCTTGG - Intronic
922349658 1:224724754-224724776 CACTTGAGGAAGCTGGAGCTTGG + Intronic
924232375 1:241972906-241972928 GACTGTTGGAAGCTGGGGCTGGG + Intergenic
924572597 1:245250998-245251020 GACTCTTGGAAGCTTGCACGTGG - Intronic
1063046108 10:2393783-2393805 GACTCTAGGAAGGTTGAGTTTGG + Intergenic
1065206363 10:23361244-23361266 GACTCTTGGAAGCTTGTGTCTGG + Intergenic
1067121218 10:43473777-43473799 CACTTTGGGAGGCTTGAGGTGGG + Intronic
1067365831 10:45627864-45627886 GACTCTAGGAAGCTTGCACTTGG + Intronic
1068121018 10:52782019-52782041 GACTCTTGGAAGCTTGCAATTGG - Intergenic
1068575159 10:58676411-58676433 CAATCTGGGATGCTCGAGCTTGG + Intronic
1069348979 10:67502821-67502843 CAAACTGGGATGCTTGAGCTTGG - Intronic
1069647410 10:70012185-70012207 GCTACTTGGAAGCTTGAGCTCGG - Intergenic
1069735088 10:70648730-70648752 CACTCATGTGAGCTTGTGCTTGG + Intergenic
1070461420 10:76674290-76674312 CACTATCAGAAGCTTCAGCTTGG - Intergenic
1072326831 10:94307084-94307106 CAGTTTTGGAAGCTGGGGCTGGG + Intronic
1072748537 10:97959302-97959324 GACTCTTGGAAGCTTGTGCCTGG - Intronic
1073203889 10:101758394-101758416 CATTCTGGGAAGCCTGAGCTTGG + Intergenic
1073442434 10:103560323-103560345 CCCTCCTGGAATCTTGAGGTGGG + Intronic
1074221645 10:111443952-111443974 CACTCTTAGAGGCAGGAGCTAGG + Intergenic
1074652169 10:115536263-115536285 GAATCTGGGAAGCTTGAACTGGG - Intronic
1076389799 10:130090700-130090722 CAACCTGGGATGCTTGAGCTTGG + Intergenic
1076601983 10:131663221-131663243 CACTCCTGGAAGCTAGGGCCAGG + Intergenic
1076886598 10:133265891-133265913 GACTCTTTGAACCTTAAGCTTGG - Intronic
1078119337 11:8490407-8490429 CAGTCAGGGAAGCTTGAACTGGG + Intronic
1080263671 11:30378313-30378335 CAGTCTTCCAAGCTTGAGCCTGG - Intergenic
1080710059 11:34738120-34738142 CAACCTGGGAAGCTGGAGCTTGG + Intergenic
1080852356 11:36080775-36080797 GACTCTTGGAAGCCTGAACCTGG - Intronic
1080871662 11:36241900-36241922 CACTGCTGGAAGCCTGAGCCAGG + Intergenic
1080917414 11:36673881-36673903 GCCTCTGGGAAGCTTGAACTGGG + Intergenic
1080977153 11:37356858-37356880 CAACCTGGGATGCTTGAGCTTGG + Intergenic
1081310398 11:41563515-41563537 CACTCTTGGAAGGCTGAGGTGGG - Intergenic
1081465346 11:43311812-43311834 CCTTTTTGAAAGCTTGAGCTTGG - Intergenic
1082025701 11:47569944-47569966 CACTTTGGGAGGCTTGAGATGGG + Intronic
1085257470 11:75183831-75183853 TACTCAGGCAAGCTTGAGCTCGG + Intronic
1085737286 11:79049878-79049900 AACTCTTGGAAGCTTTTGCCCGG + Intronic
1086928728 11:92669230-92669252 CACCCTTGAAGGCTTGGGCTTGG + Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1087848779 11:103004248-103004270 CACTTTTGGGAGGTTGAGGTGGG - Intergenic
1089134127 11:116235612-116235634 TAGGCTTGGAAGTTTGAGCTTGG - Intergenic
1092720188 12:11433422-11433444 CAATCTTGCAAGCTTGGGCCAGG - Intronic
1095244576 12:39904112-39904134 AACCCTTGGAAGCTTGGGCTTGG - Intronic
1095694866 12:45132835-45132857 CAACCTAGGATGCTTGAGCTTGG + Intergenic
1097165163 12:57080642-57080664 CACTTTTGGGAGGTTGAGGTGGG + Intronic
1097435560 12:59549195-59549217 CAACCTGGGATGCTTGAGCTTGG - Intergenic
1099003243 12:77205996-77206018 CACTTTTGGAGACTTGAGATGGG + Intergenic
1100617493 12:96242297-96242319 CACTGTTGGAAGCTTGTACCTGG - Intronic
1101085629 12:101232938-101232960 CACTTTGGGATGCTTGAGGTAGG + Intergenic
1101314418 12:103616163-103616185 CACTCTTGGGAGCTTGGATTGGG + Intronic
1102769777 12:115465378-115465400 AACTCCAGGAAGCTTGAGCAAGG - Intergenic
1104021721 12:124996569-124996591 CACTTTTGGAAGGCTGAGGTCGG - Intronic
1104547570 12:129726148-129726170 GACTCTTGGGAGCTTGGGCCTGG + Intronic
1104558379 12:129822413-129822435 GACCCTTGGGAGCTTGAGCCTGG - Intronic
1105270140 13:18865524-18865546 AACTCCTGGAGGCTTGAGCCTGG + Intergenic
1106153790 13:27133000-27133022 CCCTGGTGGAAGCTTGAGTTTGG - Intronic
1106226538 13:27790743-27790765 CTCTCTGGGAAATTTGAGCTGGG - Intergenic
1109328653 13:60900623-60900645 CAATCTGGGACGCTTGAGCCTGG + Intergenic
1110942032 13:81362835-81362857 CAACCTGGGAAGGTTGAGCTTGG + Intergenic
1111742721 13:92224813-92224835 GACTCTTAGAAGCTTGTGCCTGG + Intronic
1112836897 13:103526533-103526555 CACTGCTGGCAGCTTGATCTTGG + Intergenic
1114240283 14:20860592-20860614 GCCGCTTGGAAGCTTGAACTGGG + Intergenic
1114284966 14:21232610-21232632 CACTTTGGGAGGCTTGAGTTGGG - Intronic
1115586103 14:34814720-34814742 CACTTTGGGAGGCTTGAGGTGGG - Intronic
1115912160 14:38268809-38268831 CAACCTGGGATGCTTGAGCTTGG - Intergenic
1117237972 14:53798500-53798522 CAACCTGGGATGCTTGAGCTTGG + Intergenic
1118640578 14:67788533-67788555 GACTCTTGGAAGCTTGCACCTGG + Intronic
1119509300 14:75198536-75198558 CACTCCTGGAAGCTTGAGAAGGG - Intergenic
1119542322 14:75448510-75448532 CCATCTAGGAAGCTTGAGATAGG - Intronic
1119835149 14:77742808-77742830 CACTTTGGGAAGGTTGAGGTGGG - Intronic
1122043056 14:99003566-99003588 CCCTCCTGGAGGCTAGAGCTAGG - Intergenic
1123008893 14:105337818-105337840 GACTTCTGGAAGCCTGAGCTAGG - Intronic
1125219557 15:37317659-37317681 CCACCTGGGAAGCTTGAGCTTGG + Intergenic
1126270962 15:46816240-46816262 CACTCTTGTAAGCTTGCAGTTGG - Intergenic
1126630977 15:50735149-50735171 CACTTTTGGAGGCTTGAGGTGGG - Intronic
1127373728 15:58363187-58363209 CAACCTGGGATGCTTGAGCTTGG + Intronic
1128031001 15:64479987-64480009 CACTTTGGGAGGCTTGAGGTGGG + Intronic
1129415968 15:75380229-75380251 GATTCTAGGAAGCTTGAGCCTGG + Intronic
1129563203 15:76593108-76593130 CGACCTGGGAAGCTTGAGCTTGG + Intronic
1129920107 15:79312258-79312280 CACTGAAGGAAGCTTGCGCTTGG + Intronic
1129924726 15:79353955-79353977 CACATTTGGAAGCTTGTGTTTGG + Intronic
1131133685 15:89916421-89916443 CACTTTTGGGAGGTTGAGGTGGG + Intergenic
1133775407 16:8891377-8891399 CACTTTGGGAGGCTTGAGATCGG - Intergenic
1134083519 16:11340842-11340864 CTCACTGGGAAGCTGGAGCTCGG + Intronic
1134467454 16:14492059-14492081 CACCCTTGGGAGCCAGAGCTTGG + Intronic
1134605986 16:15571598-15571620 CACTTTGGGAGGCTTGAGGTGGG - Intronic
1135631685 16:24040467-24040489 CACTCATGGTAACCTGAGCTTGG + Intronic
1135767779 16:25192685-25192707 CACTTTGGGAGGCTTGAGGTAGG + Intergenic
1136316333 16:29456544-29456566 CACACTTGGGAGGTTGAGATAGG - Intronic
1136430910 16:30195886-30195908 CACACTTGGGAGGTTGAGATAGG - Intronic
1137618134 16:49858661-49858683 CACTCTTGGACGCACAAGCTGGG - Intergenic
1138642942 16:58400266-58400288 GACTCTTGGAAGCTTGTGCCTGG - Intronic
1138845438 16:60559363-60559385 CACACTTTGAAACTTGAGTTTGG - Intergenic
1139382204 16:66539686-66539708 GACCCTTGGAAGCTTGTGCCTGG - Intronic
1140909216 16:79436769-79436791 CCCTCTTGGAAACATGAGCTGGG + Intergenic
1141515772 16:84544062-84544084 CACTCTGGGAGGCTGGAGCGGGG - Intronic
1141944448 16:87299633-87299655 GACTCTGGGATGCTTGAACTGGG - Intronic
1143336717 17:6176975-6176997 CACTCTTGCAAGCATGTGTTTGG - Intergenic
1143340374 17:6206441-6206463 GACCCTTGGAAGCTTGTGCCTGG + Intergenic
1145052675 17:19675805-19675827 AAATCTTGGAACTTTGAGCTAGG + Exonic
1146362173 17:32185965-32185987 CACTCTGAGAGGCTTGAGATGGG - Intronic
1146388254 17:32396966-32396988 CACTTTGGGAGGCTTGAGGTGGG + Intergenic
1147808555 17:43150033-43150055 CACTTTGGGAGGCTTGAGGTGGG - Intergenic
1148065704 17:44868062-44868084 CCCTCCTGGATGCCTGAGCTGGG + Intronic
1149137992 17:53393397-53393419 GACTCTTGGAAGCTTGTGTCTGG - Intergenic
1150609947 17:66725987-66726009 CACTGTGGGCAGCTGGAGCTCGG + Intronic
1155009886 18:21766790-21766812 CACTTTGGGAAGCCTGAGGTGGG + Intronic
1155665184 18:28299379-28299401 CAACCTGGGATGCTTGAGCTTGG - Intergenic
1155716483 18:28950800-28950822 GACTCTTGGAAGCTTGTGCCTGG + Intergenic
1156030567 18:32707749-32707771 CACTCTTGGAAGCTTGAGCTGGG + Intronic
1156349630 18:36292550-36292572 CACTCTTGGAATATTGGCCTGGG - Intergenic
1157661192 18:49446733-49446755 AACTCTTGGAAGCTTTCCCTTGG - Intronic
1157724204 18:49951165-49951187 GACTCTTGGAAGCTTGTGCCTGG + Intronic
1158466391 18:57693959-57693981 GACTTTTGGAAGCTTGTGCCTGG + Intronic
1158474930 18:57771503-57771525 GATTTTTGGAAGCTTGAGCAAGG - Intronic
1161564949 19:4996839-4996861 CACTCTTGCTATCTTGAGCTGGG + Intronic
1162266061 19:9575496-9575518 CACTCTGGGAAGGCTGAGATGGG + Intronic
1162339347 19:10082698-10082720 GACCCTTGGAGGCTTAAGCTGGG - Intergenic
1163847348 19:19645287-19645309 CGCCCTTGGAAGACTGAGCTGGG - Exonic
1163928505 19:20367043-20367065 CACTCTGGGAAGACAGAGCTGGG - Intergenic
1166634228 19:44435429-44435451 GACTCTTGGAAGCTTGCACCTGG - Intronic
926048014 2:9724414-9724436 CACTGTTGGAAACATGAGCCTGG - Intergenic
928342227 2:30454560-30454582 TACTCTGGGAAGCTTGAGATGGG - Intronic
929229141 2:39541316-39541338 CCCTCTTGGAAGCTTGAGCTTGG + Intergenic
929505221 2:42523054-42523076 CACTCTGGGAGGCCTGAGATGGG - Intronic
931276498 2:60748099-60748121 CAATCTTGGGAGCTAGTGCTAGG - Intergenic
931565026 2:63607289-63607311 CACTTTGGGAAGCTTGAGATGGG + Intronic
932051569 2:68403571-68403593 CAACCTAGGAAGCTGGAGCTTGG - Intergenic
932194221 2:69769174-69769196 CACTATTCGAAGCTTGAGCCTGG + Intronic
932443874 2:71759496-71759518 CAATCTTGGAATCTGGGGCTAGG + Intergenic
933413206 2:81951058-81951080 CAACCTGGGATGCTTGAGCTTGG - Intergenic
933807418 2:86010209-86010231 CAGACTTGCAGGCTTGAGCTTGG - Intergenic
934101277 2:88655553-88655575 GACTCTTGGAAGCTTAAGTCTGG + Intergenic
937845624 2:126575834-126575856 GCCTCTTGGAAGCTTGTTCTTGG - Intergenic
938144737 2:128823975-128823997 CAATCTGGGATGCCTGAGCTTGG + Intergenic
938582918 2:132663519-132663541 CACTTTGGGAAGCTTGAGGTAGG - Intronic
938747120 2:134289857-134289879 GATTCTTGGAAGCTTGTGCCTGG + Intronic
939382044 2:141448269-141448291 CAACCTGGGATGCTTGAGCTTGG - Intronic
939687154 2:145213677-145213699 CAACCTGGGATGCTTGAGCTTGG - Intergenic
940054534 2:149500067-149500089 CAATCTGGGACACTTGAGCTTGG - Intergenic
940760951 2:157738700-157738722 CAGTCCTGGAAGCTAGAGGTAGG + Intronic
941115012 2:161462254-161462276 CAACCTGGGACGCTTGAGCTAGG - Intronic
941275556 2:163486305-163486327 CACTCTTGGTCGTTTGAGCTTGG + Intergenic
941682339 2:168412898-168412920 CAACCTGGGATGCTTGAGCTTGG - Intergenic
941727240 2:168874823-168874845 CACTCTTGAAAGCTTGTGCCAGG + Intronic
942410744 2:175707017-175707039 GACTCTTGGAAGCTTGAACTTGG + Intergenic
943031116 2:182687027-182687049 CCCGCTGGGAAGCTTGAACTAGG + Intergenic
944392396 2:199230271-199230293 CACTCATGAGAGCTTGTGCTTGG - Intergenic
944568885 2:201022097-201022119 CACTCTTGGAGGCTGTATCTGGG + Intronic
944572000 2:201054245-201054267 GATTCTTGCAAGCTTGAGCTTGG + Intronic
944631750 2:201633827-201633849 GACTCTTGGAAGCTTGTACTTGG - Intronic
944934648 2:204555170-204555192 GACCCTTGGAAGCTTGTGCCTGG + Intronic
948513820 2:238490349-238490371 CACACCTGGAAGCTTGAGCCTGG - Intergenic
1171084878 20:22228896-22228918 AACTGCTGGAAGCTTGAGATTGG + Intergenic
1171284670 20:23927124-23927146 CACTGCTGGAAGCCTGAGCTTGG - Intergenic
1171311476 20:24148569-24148591 CACACGTGCACGCTTGAGCTGGG + Intergenic
1171361864 20:24591762-24591784 TACCCTTGGAAGCATGACCTGGG - Intronic
1172873858 20:38152535-38152557 CAGTCTTGGCATCCTGAGCTGGG - Intronic
1174519159 20:51116389-51116411 GACTCTTGGAAGCTTGTGCCTGG - Intergenic
1175086263 20:56461676-56461698 AACTCTTGGAAGCTTGTGCCTGG - Intergenic
1175646223 20:60674446-60674468 CAATCGTGGAACCTTGAGCCGGG + Intergenic
1176006985 20:62870812-62870834 AATTCTTGGAAGGTTGAGCAGGG + Intergenic
1177409997 21:20717662-20717684 GACTCTTGGAAGCTTGCACCTGG - Intergenic
1178271048 21:31190157-31190179 CACTCTTGGAAGGCTGAGGCGGG + Intronic
1180075561 21:45459749-45459771 CACTCTTGGCAGCTGCAGCAAGG - Intronic
1182728953 22:32472057-32472079 CATTCTTGGAAGCTTAGCCTGGG + Intergenic
1183142131 22:35952214-35952236 GACTTTTGGAAGCTTGAGTCAGG + Intronic
949501155 3:4681107-4681129 CACTCATGGAAGCTTGGGCTTGG - Intronic
949516505 3:4812281-4812303 CACTTTGGGAAGCTAAAGCTGGG - Intronic
949580612 3:5384129-5384151 CAACCTAGGATGCTTGAGCTCGG - Intergenic
949641036 3:6036241-6036263 CAACCTGGGATGCTTGAGCTTGG - Intergenic
953514246 3:43574199-43574221 CACTTTGGGAAGCTTGAGGCAGG - Intronic
956186387 3:66566635-66566657 CACTTTTGGGAGCCTGAGATGGG - Intergenic
956541119 3:70340746-70340768 GACTCTTGGAAGCTTGCACCTGG + Intergenic
956870787 3:73415405-73415427 GACTCTTGGAGGCTTCAGGTTGG + Intronic
957391081 3:79570330-79570352 CTCTCTTGGAAGCCTAAGCAGGG - Intronic
958103844 3:89048204-89048226 CACTCCTGGAAGATGGAGGTGGG + Intergenic
958660891 3:97065667-97065689 CACTTTGGGAAGTTTGATCTTGG - Intronic
959097408 3:101971148-101971170 CAATCTGGGATGCTGGAGCTTGG - Intergenic
959582520 3:107996378-107996400 GACCCTTGGAAGCTTGTGCCTGG - Intergenic
959859743 3:111203816-111203838 CACTCTTGGATTCTCTAGCTTGG + Intronic
962530547 3:136276550-136276572 CTCTCTTGCAAGCCTGAACTTGG + Intronic
962649214 3:137471768-137471790 AACTCTTGGAAGCTTATGCCTGG + Intergenic
963930906 3:151003511-151003533 GACTCTTGGAAGCGTGTGCCTGG + Intergenic
963980239 3:151528990-151529012 CAACCTGGGATGCTTGAGCTTGG + Intergenic
964288645 3:155150627-155150649 CATTCTAGGGTGCTTGAGCTGGG - Intronic
965965294 3:174481732-174481754 GACTCTTGGAAACTTGCACTGGG - Intronic
967094196 3:186163249-186163271 CACTTTGGGAAGCTTGAGGAGGG - Intronic
967348411 3:188484880-188484902 AACTCTGGGAAGCTTGAGTTGGG - Intronic
967905384 3:194495373-194495395 AACTCTTGGTAGCTTGAAATTGG - Intronic
968311739 3:197689272-197689294 CACTCTGGGAGGCTTGAGGTAGG - Intronic
969614401 4:8244014-8244036 CACTCTTGGAACCTTGGGGTAGG - Intergenic
970923003 4:21417061-21417083 CACTCTTGGAAAATCGAACTGGG + Intronic
971289886 4:25327725-25327747 CACTCTAGGAAGCCTGAGGCAGG - Intronic
971878643 4:32339363-32339385 ATCTCTTGGAAGCTTGAGAGAGG + Intergenic
972389413 4:38600703-38600725 CACTGTTGGCACCTTGACCTTGG - Intergenic
973228183 4:47810429-47810451 AACATTTGGAAGCTTGAGGTGGG - Intronic
976023937 4:80664583-80664605 CAACCTGGGATGCTTGAGCTTGG - Intronic
976363058 4:84202898-84202920 CAACCTGGGATGCTTGAGCTTGG + Intergenic
976715938 4:88122457-88122479 CAACCTGGGAAGCTTGAGCTTGG + Intronic
978028661 4:103910878-103910900 CACTCTTGAACTCTTGATCTCGG + Intergenic
978186325 4:105860600-105860622 GAGTCCTGGAAGCTTGAACTGGG + Intronic
979172565 4:117620695-117620717 CACGCTGGGAAGCTTGACCAAGG - Intergenic
979228556 4:118319920-118319942 CACTTTTGGGAGGTTGAGGTGGG - Intronic
979683586 4:123487086-123487108 CACTTTGGGAGGCTTGAGATAGG + Intergenic
980049019 4:128020382-128020404 GACTCTTGGAAGCTTGTTCTTGG - Intronic
981186651 4:141811421-141811443 GACTCTTGGAAGCTTGTACCTGG + Intergenic
981971267 4:150665082-150665104 GACTCTTGGAAGCTTGTACCTGG - Intronic
982393620 4:154892280-154892302 CGACCTGGGAAGCTTGAGCTTGG + Intergenic
982805875 4:159761646-159761668 GAGCCTTGGAAGCTTGAGCCTGG - Intergenic
983029824 4:162785814-162785836 TGCTCTTGGAAGCTTGTGCCTGG - Intergenic
983167700 4:164497570-164497592 CAACCTGGGATGCTTGAGCTTGG - Intergenic
983220062 4:165035447-165035469 GACTTTTGGAAGCTTACGCTTGG - Intronic
983949454 4:173622407-173622429 CAATCTGGGATGCTCGAGCTTGG - Intergenic
984354202 4:178637269-178637291 CAACCTGGGAAGCTCGAGCTTGG + Intergenic
984396124 4:179201965-179201987 CACTTTTGGAAGCAAGACCTGGG - Intergenic
988252371 5:28776272-28776294 CATTCTTGGAAATATGAGCTAGG + Intergenic
989512956 5:42309580-42309602 CCCTCTTGGTAGCTTTAGATTGG - Intergenic
990263319 5:54048647-54048669 CACTTTTGGGAGGTTGAGGTGGG - Intronic
990810437 5:59716218-59716240 CACCCATGTAAGCTTGTGCTTGG + Intronic
990833482 5:59986974-59986996 GACTCTTGGAAGCTTATGTTTGG + Intronic
990897594 5:60715768-60715790 CAACCTGGGATGCTTGAGCTTGG - Intergenic
990991251 5:61686177-61686199 TACTCTTGGAACCCTTAGCTTGG + Intronic
991194124 5:63911988-63912010 CACTCTTGGATTCCTTAGCTTGG - Intergenic
991221292 5:64222466-64222488 AACTCTTGGAAGCTTGCACCTGG - Intronic
994638762 5:102378377-102378399 CACTTTGGGAAGCCTGAGTTGGG - Intronic
995361194 5:111299264-111299286 CACTCATGTGAGCTTGTGCTTGG + Intronic
995612362 5:113923891-113923913 CAACCTGGGATGCTTGAGCTTGG + Intergenic
995808558 5:116080465-116080487 CAACCTGGGACGCTTGAGCTTGG + Intergenic
996283639 5:121762903-121762925 GACACATGGAAGCTTGAACTTGG + Intergenic
997332179 5:133072281-133072303 GACTCTGGGAAGCTTGTGCCTGG - Intronic
997521365 5:134526274-134526296 AACTTTTGGAAGGGTGAGCTTGG + Exonic
997632981 5:135384096-135384118 CAAGCTTGGAAGATTGAGGTAGG - Intronic
997635852 5:135405081-135405103 CACTGGTGGAACATTGAGCTTGG - Intergenic
998825644 5:146098612-146098634 CATTCCTGGAGGCTTGACCTTGG + Intronic
1000053374 5:157581238-157581260 GCCTGATGGAAGCTTGAGCTTGG - Intergenic
1000411558 5:160938666-160938688 CACCCATGAAAGCTTGTGCTTGG - Intergenic
1001006691 5:168058033-168058055 CACTCATGTGAGCTTGTGCTTGG - Intronic
1001100108 5:168807318-168807340 GACTCTTTGAATCTTGAGTTGGG - Intronic
1002915480 6:1524935-1524957 CACTCTGGGAGGCTGGGGCTGGG + Intergenic
1002996118 6:2286812-2286834 CAACCTGGGATGCTTGAGCTTGG + Intergenic
1003434405 6:6072468-6072490 CACCCTGGGATGCTGGAGCTTGG - Intergenic
1003512075 6:6790094-6790116 CACTCCTGGAAGTATGAGCAGGG - Intergenic
1004189340 6:13450535-13450557 GACTCTTGGGAGCTTGGGCCTGG - Intronic
1004207736 6:13608004-13608026 CACTTTTAGGAGCTTGAGCTAGG - Intronic
1004530233 6:16447742-16447764 CACTCTTAGAAGCTTTATATAGG + Intronic
1006934773 6:37709810-37709832 CACTGTGGGGAGCTGGAGCTCGG - Intergenic
1008159006 6:48054258-48054280 TACTCTTAGAAGCTTAATCTTGG + Intronic
1008274069 6:49523181-49523203 AACTCTTGGAAGCTTGTGCCTGG - Intronic
1008619316 6:53256422-53256444 CACTTTGGGAGGCTTGAGATGGG + Intergenic
1008785113 6:55158592-55158614 CAACCTGGGATGCTTGAGCTTGG + Intronic
1008801739 6:55377036-55377058 CACTCTTGGCTGCTTGAGCAGGG - Intronic
1008865422 6:56204260-56204282 CAGTCTGAGATGCTTGAGCTTGG + Intronic
1009880509 6:69560756-69560778 CAACCTGGGAGGCTTGAGCTTGG + Intergenic
1010017811 6:71124826-71124848 CACTCTGGGATTTTTGAGCTGGG + Intergenic
1010656746 6:78520428-78520450 CACTCTTGAAATCTTAAACTTGG - Intergenic
1010730394 6:79384722-79384744 GACTTTTGGAAGCTTGTGCCTGG - Intergenic
1011387684 6:86815486-86815508 CAACCTGGGATGCTTGAGCTTGG - Intergenic
1011766266 6:90623394-90623416 AAGTCTGGGATGCTTGAGCTTGG + Intergenic
1012644405 6:101661328-101661350 CAACCTGGGATGCTTGAGCTTGG - Intronic
1014058490 6:117043942-117043964 CAACCTGGGATGCTTGAGCTTGG - Intergenic
1015359059 6:132315291-132315313 GGCTCTTGGAAGCTTGCGCCTGG + Intronic
1016545449 6:145218056-145218078 CAGTCTTGGAAGCTTGTGCTTGG + Intergenic
1017250973 6:152279014-152279036 CACTTTTGGAAGGCTGAGGTGGG - Intronic
1019233497 6:170588114-170588136 CAATCTTGGAAAATTGATCTAGG + Intergenic
1019342339 7:514440-514462 CACTCTCGGCATCTTGAGCTGGG - Intronic
1020342531 7:7127624-7127646 AACCCTTGGAAGCTTGTGCCTGG + Intergenic
1020358280 7:7301160-7301182 CAACCTGGGATGCTTGAGCTTGG - Intergenic
1020519588 7:9169226-9169248 CAACCTGGGATGCTTGAGCTTGG - Intergenic
1021322314 7:19227188-19227210 CAACCTGGGATGCTTGAGCTTGG + Intergenic
1021394837 7:20134178-20134200 TACTCTTGGAAGGTGGAGGTAGG + Intergenic
1021700437 7:23314430-23314452 CACTTTTGGAAGGCTGAGGTGGG - Intronic
1021922801 7:25503681-25503703 CAGACCAGGAAGCTTGAGCTTGG - Intergenic
1022725183 7:32974844-32974866 GAATCTTGGAAGCTTTAGATTGG + Intronic
1023860147 7:44213590-44213612 CACCCATGGAAGCTTCTGCTGGG + Exonic
1024220217 7:47281301-47281323 CACTCTTGGAAGGAAGGGCTGGG - Intronic
1024594325 7:50919142-50919164 GAGTCTTGGAACCTTGATCTTGG + Intergenic
1025048418 7:55713001-55713023 GAATCTTGGAAGCTTTAGATTGG - Intergenic
1027242076 7:76337471-76337493 GACTCTTGAAAGCTTGCGCCTGG + Intronic
1027570572 7:79860654-79860676 CACTCTTGGATTCCTTAGCTTGG + Intergenic
1028340940 7:89719096-89719118 CAACCTGGGAAGCTGGAGCTTGG + Intergenic
1028570496 7:92281089-92281111 GACTCTTGGAAGCTTGTGCTTGG - Intronic
1029746683 7:102519296-102519318 CACTTTGGGAGGCTTGAGATCGG + Intergenic
1029764622 7:102618271-102618293 CACTTTGGGAGGCTTGAGATGGG + Intronic
1029839916 7:103351333-103351355 GACCCTTGGAAGCTTGTGCCTGG - Intronic
1029845257 7:103406032-103406054 CAACCTGGGACGCTTGAGCTTGG - Intronic
1030141034 7:106304320-106304342 CGATCTGGGACGCTTGAGCTTGG - Intergenic
1030159541 7:106493159-106493181 CAACCTGGGATGCTTGAGCTTGG + Intergenic
1031843921 7:126781311-126781333 CAGTGTTGGAACCTTGAACTTGG - Intronic
1032907763 7:136391354-136391376 AGCTCCTGGAAACTTGAGCTTGG - Intergenic
1033011366 7:137626056-137626078 GACTCTTGGAAGCTTGTGCCTGG + Intronic
1033208218 7:139440500-139440522 CACTTTTGGGAGGTTGAGGTGGG - Intergenic
1034052135 7:147995008-147995030 GTCTCTTGGAAGCTTGTGTTTGG - Intronic
1035794065 8:2337198-2337220 CAACCTGGGATGCTTGAGCTTGG + Intergenic
1035798740 8:2384510-2384532 CAACCTGGGATGCTTGAGCTTGG - Intergenic
1035967021 8:4203852-4203874 CACTTTTGGAAGGCTGAGGTAGG + Intronic
1040768554 8:50945328-50945350 CACTTTTGGGAGGTTGAGGTGGG - Intergenic
1043004041 8:74796217-74796239 TATTCATGGAAGCTTGAACTAGG - Intronic
1043058197 8:75466928-75466950 CACTTTAGGAATCTTGAGTTAGG - Intronic
1044209660 8:89535709-89535731 CAGCCTGGGAAGCTTGAACTGGG + Intergenic
1045685962 8:104712677-104712699 GACTCTTGGAAGTTTGCCCTTGG + Intronic
1046067984 8:109218863-109218885 CACCCTGGGATGCTCGAGCTTGG - Intergenic
1046316470 8:112509333-112509355 CACTTTGGGAGGCTTGAGGTGGG - Intronic
1047743586 8:127827239-127827261 CACTTTTGGAGGCTTGAGGCAGG - Intergenic
1047961457 8:130015014-130015036 CATTCTTGGAAGATTGCACTGGG - Intronic
1047996574 8:130342420-130342442 CACTCTTGGTAGAATGTGCTGGG - Intronic
1050963330 9:11765849-11765871 CAACCTGGGATGCTTGAGCTTGG + Intergenic
1051124812 9:13791937-13791959 CAACCTGGGATGCTTGAGCTTGG + Intergenic
1052096588 9:24391334-24391356 CAACCTAGGATGCTTGAGCTTGG - Intergenic
1054893885 9:70285286-70285308 GACCCTTGGAAGCTTGTGCCTGG - Intronic
1055033739 9:71796262-71796284 GGCTCTTGGAAGCTTGTGCTTGG - Intronic
1055048242 9:71953162-71953184 CACTCTTGACATGTTGAGCTGGG - Intronic
1055407849 9:75993746-75993768 GTCTCTTGGAAGCTTGATCCTGG - Intronic
1055628756 9:78201235-78201257 CAACCTGGGATGCTTGAGCTTGG + Intergenic
1055901135 9:81239437-81239459 GACACATGGAAGCTTGTGCTTGG - Intergenic
1056161080 9:83894712-83894734 AAGTCTTGGAAGCTTGTGCCTGG + Intronic
1056359051 9:85834550-85834572 AAGTCTTGGAAGCTTGTGCCTGG - Intergenic
1056751418 9:89354382-89354404 GACTTTTGGAAGCTGGAGCCTGG - Intronic
1056896605 9:90556656-90556678 CACTTCTGGAAGCTTGTACTTGG + Intergenic
1057439914 9:95075632-95075654 CACTTTCGGAAGCTTAAGGTGGG + Intronic
1057460316 9:95254864-95254886 CAACCTGGGATGCTTGAGCTTGG + Intronic
1058289129 9:103215239-103215261 AACTCTTGGAAGCTTGCACTAGG + Intergenic
1059475991 9:114548148-114548170 CACTCCAGGAAGCATCAGCTGGG + Intergenic
1061729505 9:132602687-132602709 CACTCTTGGAAGTTTGGCCAAGG + Intronic
1187056863 X:15748801-15748823 CACTTTGGGAGGCTTGAGGTGGG + Intronic
1188274533 X:28183231-28183253 GACACTTGGAAGCTTGTGCCTGG + Intergenic
1190083777 X:47377539-47377561 TACTCTTGGGAGGTTGAGGTGGG - Intronic
1190293465 X:49009149-49009171 GACTCTTGGAAGCCTGTGCCTGG + Intergenic
1191657445 X:63613755-63613777 CAACCTGGGATGCTTGAGCTTGG + Intergenic
1191947753 X:66554079-66554101 CAATCTGGGATGCTGGAGCTTGG + Intergenic
1192670447 X:73134898-73134920 GACTCTTGGAAGCTTGTACCTGG - Intergenic
1192834510 X:74785045-74785067 GACTCTTGGAAGCTTGCACCTGG + Intronic
1193284622 X:79697138-79697160 CAACCTGGGATGCTTGAGCTTGG - Intergenic
1193646770 X:84079612-84079634 CAAACTTGGACACTTGAGCTTGG + Intronic
1194515328 X:94845045-94845067 CAACCTGGGATGCTTGAGCTTGG - Intergenic
1194565292 X:95479379-95479401 CACTTTGGGAGGCTCGAGCTGGG - Intergenic
1196281174 X:113825369-113825391 CAACCTGGGACGCTTGAGCTTGG - Intergenic
1198015411 X:132605374-132605396 GACTCTTGGAAGCTTGTACATGG - Intergenic
1199253599 X:145693382-145693404 TACTGTCTGAAGCTTGAGCTGGG + Intergenic
1201409976 Y:13689888-13689910 CACTTTGGGAGGCTTGAGGTGGG - Intergenic
1201708559 Y:16964119-16964141 CACTCATGGGACCTGGAGCTAGG - Intergenic