ID: 1156031990

View in Genome Browser
Species Human (GRCh38)
Location 18:32723420-32723442
Sequence ATTTGCTTTCAGAAGACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 288}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156031988_1156031990 -5 Left 1156031988 18:32723402-32723424 CCTCTGGCTTCTGGATGGATTTG 0: 1
1: 1
2: 21
3: 107
4: 359
Right 1156031990 18:32723420-32723442 ATTTGCTTTCAGAAGACTGAGGG 0: 1
1: 0
2: 4
3: 27
4: 288
1156031984_1156031990 15 Left 1156031984 18:32723382-32723404 CCAAATTAGGGGCTCTCTTGCCT 0: 1
1: 0
2: 0
3: 18
4: 116
Right 1156031990 18:32723420-32723442 ATTTGCTTTCAGAAGACTGAGGG 0: 1
1: 0
2: 4
3: 27
4: 288
1156031980_1156031990 28 Left 1156031980 18:32723369-32723391 CCAGTGGTACTGACCAAATTAGG 0: 1
1: 0
2: 1
3: 2
4: 66
Right 1156031990 18:32723420-32723442 ATTTGCTTTCAGAAGACTGAGGG 0: 1
1: 0
2: 4
3: 27
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156031990 Original CRISPR ATTTGCTTTCAGAAGACTGA GGG Intronic
900966474 1:5962394-5962416 CTGTGCTCTCAGGAGACTGAGGG - Intronic
901104715 1:6746227-6746249 ATTTGCTTTCAAAAAAGGGATGG + Intergenic
901604966 1:10452179-10452201 ATTTGCTTTGGGAGGAATGAAGG + Intergenic
901954483 1:12774446-12774468 ACATGCTTGCAGAAGACTAAAGG - Intergenic
904224252 1:29001643-29001665 ATTTGCCTTCAGAATTTTGAAGG + Intronic
904579468 1:31530516-31530538 ATTTCCTTGCAGAAGAGTCATGG - Intergenic
904689540 1:32283466-32283488 ATCTTTGTTCAGAAGACTGAAGG + Intronic
906255914 1:44350044-44350066 CCTTGCTTGTAGAAGACTGATGG - Intronic
906394641 1:45451462-45451484 ATTTGATTTGGGAAGCCTGAGGG + Intronic
907109428 1:51913372-51913394 ACTTAGTTTCAGAGGACTGAGGG + Exonic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
910606635 1:89092432-89092454 GGTTGCTTTCAGAAGCCTGGTGG + Intergenic
912143357 1:106759058-106759080 ATTCTTATTCAGAAGACTGAAGG + Intergenic
912785067 1:112594653-112594675 ATCTGAATTCAGAAGACAGATGG + Intronic
915457789 1:156052192-156052214 ATTGGGTCTCAGAAGGCTGAAGG - Intronic
915783334 1:158578945-158578967 AAATGCTTTTAGAAGAATGATGG - Exonic
916242394 1:162653155-162653177 ATTTGCTTTGATCACACTGAAGG - Intronic
916907780 1:169307368-169307390 ATTTGTGTTCAGAAGACTATGGG + Intronic
917433446 1:174995647-174995669 AGTTGCTTTCAGAGTCCTGATGG - Intergenic
918634180 1:186755220-186755242 TTTTACTTACATAAGACTGATGG - Intergenic
919187597 1:194173322-194173344 AATTGATTTTAGAAGACTTATGG + Intergenic
922374838 1:224952152-224952174 AGTTTCTTTCTGATGACTGAGGG - Intronic
924448137 1:244153103-244153125 AATTCCTTTGACAAGACTGAAGG - Intergenic
1063818631 10:9808172-9808194 TTTTTCTTTCAGAAGACACAAGG - Intergenic
1063941873 10:11138629-11138651 GTTTACTTTTAGAAGACTGGGGG + Intronic
1064348879 10:14558341-14558363 TCTAGCTTTCAGAAGACTCAGGG + Intronic
1064819671 10:19312809-19312831 ATTTCCTTTCAGAAGAATCTGGG + Intronic
1065609217 10:27454671-27454693 ATTTTCTTTCAGAAGGGAGAAGG + Intergenic
1067522162 10:47016138-47016160 AGGTGCTTTCAGGAGACTGTAGG - Intergenic
1069763612 10:70834537-70834559 ATTTGCTTACAAAAGAAAGACGG - Intronic
1070304207 10:75228772-75228794 CTTTGCTTTCAGCATTCTGAGGG - Intronic
1070344562 10:75529312-75529334 TTTTCCTTTCAGAATTCTGAAGG - Intronic
1070500491 10:77068022-77068044 ATTTCCTTTCAGTATACTCAAGG + Intronic
1071936492 10:90537305-90537327 TTTTGCTTTGGGAAGACAGACGG + Intergenic
1072748290 10:97957668-97957690 ATCCACTTTCAGAAGACTGAAGG - Intronic
1073692967 10:105831910-105831932 ATTTTCTATCAGAAGAAGGAAGG + Intergenic
1074435028 10:113426655-113426677 ATTAGCTCTCAGAAAACGGAAGG + Intergenic
1077457493 11:2689741-2689763 ATTTGTTTACAGGAGACTGATGG + Intronic
1078480455 11:11671197-11671219 ATTTGCTGTTAGAAGGCTGCAGG - Intergenic
1080013800 11:27484089-27484111 AGTCGCCATCAGAAGACTGAAGG + Intergenic
1081136327 11:39444010-39444032 TTTTTTTTTGAGAAGACTGAAGG - Intergenic
1082018016 11:47506752-47506774 AGTTGCTTTCAGAAAGGTGATGG - Intronic
1082709133 11:56531813-56531835 ATTTATTTTCAGTAGACTAAAGG - Intergenic
1083032057 11:59601887-59601909 ATGGGCTTGCAGAAGCCTGAGGG - Intronic
1085328549 11:75627574-75627596 ATTTGCTTTCAGACTAATGATGG + Intronic
1086495232 11:87397430-87397452 ATTTGCTTTTAGCTGACTCATGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088642749 11:111889216-111889238 GTCTGCCATCAGAAGACTGAAGG - Intergenic
1090523813 11:127507072-127507094 CCTTGCTTTCAGAAGCCAGAGGG - Intergenic
1090661148 11:128882493-128882515 ACTTGGTTTCAGAAGGCTGGTGG + Intergenic
1090860120 11:130645579-130645601 ATTTGGTTTCAAAAGAGGGAAGG - Intergenic
1093532741 12:20186724-20186746 ATTTGGTAGTAGAAGACTGAGGG - Intergenic
1097245031 12:57603160-57603182 TCTTCCTGTCAGAAGACTGATGG + Exonic
1097354316 12:58584551-58584573 ATTTGCTTTCTGTATACCGATGG - Intronic
1097466951 12:59938221-59938243 TTTTGGTTTCAAAAGACTCAGGG + Intergenic
1098239772 12:68455367-68455389 ATTTCCTTTCAGGACACTGTGGG - Intergenic
1099654022 12:85466699-85466721 ATTTCCTTTTAGAAGACACAAGG - Intergenic
1101471029 12:104997385-104997407 ATTTTCTTTAAGAATGCTGAGGG + Intronic
1101485423 12:105153308-105153330 CTTTGCTTTCAGGAGACTTTAGG + Intronic
1102003025 12:109569938-109569960 ATTTGTTTCTAGAAGACAGAAGG - Intronic
1104239721 12:126976391-126976413 GTGTGCTTTCAGAAGTCAGATGG + Intergenic
1104517807 12:129443924-129443946 ATTTGCTTTCTTAAGAATAAAGG + Intronic
1105601480 13:21892228-21892250 AGCTGCTTCCAGAAGCCTGAAGG - Intergenic
1106633484 13:31502555-31502577 ATTTGTATACAGAAAACTGAAGG - Intergenic
1106896732 13:34311015-34311037 ATTTGGATTCAGAAAAGTGAAGG - Intergenic
1107510267 13:41076609-41076631 ATGTTCTATCAGAAGACTTAAGG - Intronic
1108929416 13:55797699-55797721 TTTTGCTTTTAGAATCCTGAAGG + Intergenic
1108986899 13:56602474-56602496 TTTTGCTTTCAGAAGTCGTAAGG + Intergenic
1109313267 13:60720178-60720200 AATTACCTTCAGAAGACTGTGGG + Intergenic
1113063874 13:106354830-106354852 ATTTGCTACCAGGAGGCTGAAGG - Intergenic
1113063967 13:106355715-106355737 ATTTGCTATCAGAAGGCTGAAGG + Intergenic
1115873738 14:37837221-37837243 ATTTGCTTTTACATGATTGAAGG + Intronic
1116471095 14:45286488-45286510 AGTTGCTTTGAAAAGACAGAAGG + Intergenic
1117447822 14:55821489-55821511 TTTTCCTTTCTGGAGACTGACGG + Intergenic
1117496499 14:56310626-56310648 TCTTCCTTTCAGATGACTGATGG - Intergenic
1117774522 14:59169071-59169093 ATTCACATTCAGAAGAATGAAGG + Intergenic
1120203392 14:81562590-81562612 ATTTGATTTTTGAAGACTAAGGG + Intergenic
1120981272 14:90291475-90291497 ATCTGCTTCCAGGAGACTGCTGG + Intronic
1121171768 14:91860408-91860430 AGTTGATTTTAGAAAACTGAAGG - Intronic
1121992993 14:98579152-98579174 ACTTGGTTTCTTAAGACTGAAGG + Intergenic
1124638369 15:31379501-31379523 ATTTCTTTCCAGAAGACTGGGGG + Intronic
1128182237 15:65614069-65614091 ATTTTTTTTCAGAAGACAGAAGG - Intronic
1128256550 15:66201375-66201397 AGTTGCTCTCAGAAGATTGTTGG + Intronic
1128653703 15:69441605-69441627 ATTTCCTTTCACAAGGCTTAGGG - Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1131301515 15:91203657-91203679 ATTTTCTTTGAGAAGAATGGAGG + Intronic
1131301545 15:91203894-91203916 AAGTGCTTTCAGAAGACCAAAGG + Intronic
1131416348 15:92262556-92262578 TTTTCCTTTCACAAGACAGAAGG - Intergenic
1132087517 15:98920682-98920704 ATTTGCTTTCACAATACTGGGGG - Intronic
1133648294 16:7785094-7785116 ATTTGCTTTCTGATGGCAGAAGG - Intergenic
1138825251 16:60311379-60311401 ATTTGATTTCAGATTGCTGACGG + Intergenic
1140727193 16:77824165-77824187 AGGTGGTTTCAGAAGAATGAAGG + Intronic
1141031649 16:80594367-80594389 CTTTGCCTTCAAAAGACTCAGGG + Intergenic
1141408385 16:83814634-83814656 ATTTACTTTCAAAAGGCTGATGG + Exonic
1141600864 16:85125510-85125532 ATTTTTTTTCAGCAGACAGAAGG + Intergenic
1143874132 17:9979176-9979198 ATTAGCATTCTGAAGACTGCAGG - Intronic
1146931683 17:36782464-36782486 CTTGGCTTTCAGAAGGCTGCAGG + Intergenic
1149404178 17:56330042-56330064 ATTTGGTTACAGCAGCCTGAAGG + Intronic
1149624129 17:58067616-58067638 ATTTCCTTTCAGGAGACAGGTGG - Intergenic
1155041780 18:22070882-22070904 CTTTCTTTTCAGCAGACTGAGGG + Intergenic
1156031990 18:32723420-32723442 ATTTGCTTTCAGAAGACTGAGGG + Intronic
1157445655 18:47745131-47745153 ATTAGCTCTGAGAAGACAGAGGG - Intergenic
1157995870 18:52555002-52555024 TTTTGAGTTCAAAAGACTGAAGG + Intronic
1159103731 18:63982594-63982616 ATTGGCTTTCAGTAGAATCAGGG - Intronic
1159814213 18:73053172-73053194 ATTATTTTTGAGAAGACTGAAGG - Intergenic
1160217383 18:76944483-76944505 ATTTGCATTAAGAATACTTAAGG + Intronic
1161057907 19:2199897-2199919 ATTTCCTCTCAGAAGAGTGGAGG + Exonic
1162752115 19:12835247-12835269 ATTTGCTTTCAGAGCCCAGATGG + Exonic
1162881502 19:13663047-13663069 AGTTGGATTCAGATGACTGAAGG - Intergenic
1163031356 19:14546140-14546162 ATCTGCTTTCAGAAAAATCATGG + Intronic
1163911763 19:20201541-20201563 ATTTGCTTTCAGCATTCTCAAGG - Intergenic
1163954215 19:20620276-20620298 ATTTGCTTTCAGCATATTCAAGG + Exonic
1166233440 19:41439480-41439502 ATTTGGTCTTAGAAGACCGAAGG - Exonic
1166859026 19:45798975-45798997 ATTTGCTTTCAGAGGAATGTTGG + Intronic
1167530425 19:50012527-50012549 ATTTGCCATCTGATGACTGATGG + Intronic
925882104 2:8361542-8361564 ATTTGCTTTCAAATGTCAGATGG + Intergenic
927224640 2:20751556-20751578 ATTTACTCTCATAAGACTGAGGG - Intronic
929305684 2:40358856-40358878 ATATGCTTCTACAAGACTGAAGG + Intronic
930886361 2:56331553-56331575 ATTTGCTTTGGGAAGATTGGGGG + Intronic
931989472 2:67775723-67775745 AATTGCTTTCCGAACACTTAGGG - Intergenic
932400488 2:71477527-71477549 ACCTGCTTACAGAAGGCTGATGG + Intronic
932642179 2:73460322-73460344 ATTTTCTTTCAGCACACTGAAGG - Intronic
933055935 2:77665151-77665173 ATTTGTGTTCAGAGGTCTGATGG - Intergenic
934759288 2:96844593-96844615 ATGTGCTCTCAGAGCACTGAGGG - Intronic
937134153 2:119537900-119537922 ATTTGCCTAAAGAAGAATGAGGG + Intergenic
937683234 2:124667003-124667025 ATGTGCTTTAAGAAGAACGATGG + Intronic
938295133 2:130173182-130173204 ATTTGCCCTCAGAGGACTGGAGG + Intronic
938461493 2:131500656-131500678 ATTTGCCCTCAGAGGACTGGAGG - Intergenic
940181075 2:150933789-150933811 TTTTGCTTTCAGAATTCTGGAGG + Intergenic
940655999 2:156488788-156488810 GTTTGCTATCAGAATGCTGAAGG + Intronic
940788361 2:158005904-158005926 ATTTGCTTCAAGGGGACTGATGG - Intronic
941746192 2:169089198-169089220 ATTTCTCTTCAGAGGACTGAAGG + Intronic
943046017 2:182863417-182863439 TTTTGCTTTCAAAATACTAAGGG - Intronic
943175738 2:184471782-184471804 ATTTCCTTTCAAAAAGCTGAAGG - Intergenic
943537296 2:189168299-189168321 ATTTGCTTTGAGAGGACAGAGGG - Intronic
944655007 2:201868572-201868594 ATTTGCATTGAGAAAACTGAGGG + Intronic
944804359 2:203266655-203266677 ATTCGCTTCCAGAAGAATCATGG + Exonic
944819650 2:203417263-203417285 ATTTGATTTTAAAAAACTGATGG + Intronic
945196961 2:207245692-207245714 ATTTGCTTACAGGTGACTGGGGG - Intergenic
945789211 2:214283144-214283166 ATTTACTGACAGAAGACTGGTGG - Intronic
948615533 2:239196474-239196496 CTTTGCTTTCTGAAGACTGAAGG + Intronic
949053709 2:241912442-241912464 ATTTCCTTTCACATGACAGATGG + Intergenic
1170074466 20:12404564-12404586 GTTTGTTTTCCGGAGACTGATGG + Intergenic
1170450972 20:16483272-16483294 ATTAGCTCACAGAAGAGTGATGG - Intronic
1177302119 21:19261344-19261366 ATTTGCTTTCAAAATTTTGAAGG - Intergenic
1178540722 21:33447261-33447283 AGTTGCTTTTAGAACACTGGTGG - Intronic
1178694888 21:34784355-34784377 ATGTGCTTTCAAAAGACAGATGG - Intergenic
1182075832 22:27494916-27494938 ATTTGTTTCCAGAAGGCCGAGGG + Intergenic
1182849735 22:33462237-33462259 ATTTTCTCTCAGCACACTGAAGG - Intronic
1184530569 22:45052603-45052625 TTTTCCTTTCACAAGCCTGATGG - Intergenic
949241912 3:1883363-1883385 ACTTCCTCTCAGAAGACTAAGGG - Intergenic
949275156 3:2270692-2270714 ATTTGCTTAAGGAAGACTGAAGG + Intronic
950586800 3:13898062-13898084 TTTTGCTTTCAAAACACTGATGG - Intergenic
951194811 3:19812361-19812383 TTTTGCTTTGAGAAGTCTGTAGG - Intergenic
951766441 3:26204720-26204742 TTTTTCTTTCAGTAGTCTGAGGG + Intergenic
952651320 3:35730230-35730252 CATTGATTTCAAAAGACTGAGGG + Intronic
955453083 3:59091543-59091565 ATTTGCTTTCACAAGATTCATGG - Intergenic
958804070 3:98788314-98788336 TTTTACTTTCAGAACACTAATGG + Exonic
959698396 3:109274201-109274223 ATTTGTCTTCAGAATAATGAAGG - Intergenic
960338589 3:116447259-116447281 ATTTGCTTACATAAGAGGGATGG - Intronic
961693102 3:128684619-128684641 ATTTTCTATCAAAAGACAGAAGG - Intergenic
962589561 3:136874864-136874886 ATTTGCCTTCAGAATTCTGAAGG + Intronic
963558112 3:146822235-146822257 ATTTTCTTTCAGAACTTTGAAGG - Intergenic
965480078 3:169207513-169207535 ATTTGCTTTCAGAATCCTGGTGG + Intronic
966673386 3:182556294-182556316 ATTTGCTTTCCTACTACTGAAGG - Intergenic
968021864 3:195399134-195399156 TTTTGCTTTCAAAAGAGTTAAGG + Intronic
968348444 3:198031592-198031614 AAATGCTTTCAGAATTCTGATGG - Intronic
968708018 4:2092429-2092451 ATTTGAATTCAGTTGACTGATGG + Intronic
970696130 4:18679546-18679568 ATTATCATTCAGAAGATTGAAGG + Intergenic
971767749 4:30855050-30855072 ATTTGCCTTCTGAAGGCGGAAGG + Intronic
971775517 4:30959617-30959639 TTTTTCTTCCAGAAGCCTGATGG + Intronic
972726391 4:41749472-41749494 ATGTGCTTTCAAGAGACTCAGGG + Intergenic
973253486 4:48085268-48085290 ATTTGCTTTCAGAGGACATAAGG - Intronic
973545552 4:51978096-51978118 AGTTGCCATCAGAAGACTGAAGG - Intergenic
974367142 4:60964760-60964782 TTTTGATTTATGAAGACTGAAGG + Intergenic
975401174 4:73941543-73941565 TTTTGCTTTCAATAGTCTGATGG - Intergenic
976534977 4:86202297-86202319 AAGTGCTGTGAGAAGACTGAGGG - Intronic
976645388 4:87381982-87382004 ATTTTCTTTCAGTAGGTTGAAGG - Intronic
976658196 4:87511371-87511393 GTTTGGTTTTAGAAGACAGACGG + Intronic
978250242 4:106622114-106622136 ATCTGCTTTCTGAAGACAGGAGG + Intergenic
979160769 4:117458195-117458217 ATTTGCTCTCCGAAAACTAAAGG + Intergenic
979281552 4:118874240-118874262 ATTAGCTTCCAGAAGCCTAAGGG + Intronic
979814595 4:125084825-125084847 ACCTCCTTTCAGAAGACTTAAGG - Intergenic
980757296 4:137181944-137181966 ATTTGAATACAGAAGATTGAAGG - Intergenic
981201305 4:141982806-141982828 ATATCCTTTTAGAAGATTGAAGG - Intergenic
981457181 4:144966427-144966449 ATTTGGGCTCAGAAGGCTGAAGG - Intergenic
983798068 4:171891250-171891272 ATTTTCTTTCAGACCACTGGAGG + Intronic
984672077 4:182502086-182502108 ATTTGCTCTCAGAATTGTGAAGG + Intronic
986428875 5:7662289-7662311 CCTTGCTTCCAGAACACTGATGG - Intronic
987159375 5:15125143-15125165 AGTTGCATTCAGAAGAGTGATGG - Intergenic
988247318 5:28703532-28703554 TTTTGCTTTGATAACACTGAAGG - Intergenic
988266514 5:28958544-28958566 ATATGATTGAAGAAGACTGATGG + Intergenic
989772868 5:45165553-45165575 ATTTTCTTTGATAAGATTGAGGG + Intergenic
991464802 5:66899696-66899718 AGTTGCTTTGGGAAGATTGATGG + Intronic
992306496 5:75445117-75445139 TTTTGTTTTCAGTAGACTAATGG - Intronic
992395449 5:76365269-76365291 ATTTGGTTTAAAAACACTGAAGG + Intergenic
992482178 5:77162948-77162970 ATTTGCTTTAACCAGACTTAAGG + Intergenic
993310410 5:86324199-86324221 TTTTGCTTTGCAAAGACTGAAGG + Intergenic
993504914 5:88696710-88696732 AATTGCTTTCAGAGGTTTGATGG - Intergenic
994045738 5:95307816-95307838 ATTGGATATCAGAAGACTTAAGG + Intergenic
995445180 5:112235004-112235026 ATTAGATTTCAGTAGAATGATGG + Intronic
998633000 5:143921493-143921515 GTTTACTTTCAGAATACAGAAGG - Intergenic
998768065 5:145510667-145510689 ATTGGCTTGCAGGAGACTGCTGG - Intronic
1000181388 5:158814894-158814916 ATTTTCCTTCAGAAACCTGAAGG - Intronic
1000761665 5:165233033-165233055 ATTTCCTTACAGGAAACTGAAGG + Intergenic
1000816177 5:165924863-165924885 ATTTACTTCCAGAAGAATTATGG + Intergenic
1000844063 5:166257121-166257143 ATTTGCTTTCAAAATTCTGGTGG - Intergenic
1000924922 5:167181736-167181758 CGTTGCTTTCAGTAGAGTGAAGG + Intergenic
1001244470 5:170095591-170095613 ATTTGTTTTCTGCAGAGTGAGGG + Intergenic
1001996837 5:176168623-176168645 ATTTACTTTCAAATGACTCAGGG + Intergenic
1002433172 5:179215880-179215902 ATTTTCCTTCAGAATTCTGAAGG - Intronic
1002920171 6:1563200-1563222 ATTCGCTTTCATATGACTTATGG - Intergenic
1004235236 6:13869505-13869527 ATTTTCTTACAGAAGAGAGAAGG - Intergenic
1005031277 6:21511437-21511459 TTTGGCTTTTAGAAGATTGATGG - Intergenic
1005707138 6:28466807-28466829 ATTTGCTTTCTGAAAATTGATGG - Intergenic
1005810086 6:29508738-29508760 CTTTGCTTTCAGAACTGTGAAGG - Intergenic
1008947715 6:57117048-57117070 ATTCTCTTTCACAACACTGAAGG - Intronic
1009732724 6:67631020-67631042 ATGTGCTTTCAGATGACCTATGG + Intergenic
1011067910 6:83348589-83348611 ATTTGGTTTCAAAATTCTGAAGG + Intronic
1011362128 6:86538702-86538724 ACTTGGACTCAGAAGACTGAAGG - Intergenic
1011877707 6:91981835-91981857 ATTTGCTATCAGAGAAATGAGGG - Intergenic
1012088513 6:94860174-94860196 ATCTGCTTTCAGAAAACTCAGGG + Intergenic
1012690330 6:102302526-102302548 AATTACTTTCAGAAGAAGGAAGG + Intergenic
1013003437 6:106047826-106047848 ATTAGCTTTGAAGAGACTGAGGG - Intergenic
1013197121 6:107854479-107854501 ATTTGCATGCAAAAGAATGAAGG - Intergenic
1013302513 6:108817890-108817912 GTCAGCTATCAGAAGACTGAAGG + Intergenic
1014640323 6:123900950-123900972 ATTTTCTTTGAGAAGATGGAAGG + Intronic
1014798771 6:125754766-125754788 GTTTGCTTTCATAATACTGTGGG + Intronic
1015438272 6:133216178-133216200 ATTTGCTTTCAGAGGCATGGAGG - Intergenic
1016620747 6:146106633-146106655 ATTTGTATTCAGCAGCCTGAAGG + Intronic
1017472277 6:154750725-154750747 AATTGCTTACAGTAGACTTAAGG - Intronic
1018223210 6:161602596-161602618 ATTTGCTCTCTGTAGACTGCTGG + Intronic
1018223771 6:161607959-161607981 ATTTTCTTTCAGAATGTTGAAGG - Intronic
1019053725 6:169205000-169205022 AATTGCTTTCAAAATTCTGATGG - Intergenic
1019397097 7:826996-827018 ATTTTATTTCAGAACACTCAAGG + Intronic
1020493180 7:8814816-8814838 ATTCCCTTTAAGAAAACTGACGG + Intergenic
1020743043 7:12046338-12046360 GTTTGCTTTCAGAATACTTTGGG + Intergenic
1020801248 7:12734765-12734787 ATTTGATTGCAAAAGACTCACGG - Intergenic
1021060572 7:16105677-16105699 GGTTGCCTTCAGAAGCCTGATGG + Intronic
1022564324 7:31382352-31382374 GTTTGCTCTCAGAAGAAAGAAGG + Intergenic
1022794398 7:33720487-33720509 CTTTGTTTTCCGAAGAATGATGG + Intergenic
1023549245 7:41351461-41351483 ATTTTTTTTCAGAAGGTTGAAGG - Intergenic
1023826476 7:44013369-44013391 ATTTACTAGCAGAACACTGAGGG + Intergenic
1024174915 7:46829050-46829072 ATTTTGTTTCAGAAGGCTGAAGG - Intergenic
1024482486 7:49878501-49878523 ATTTTCTTTCAAAACTCTGAAGG + Intronic
1026090053 7:67292239-67292261 ATTTACTAGCAGAACACTGAGGG + Intergenic
1026746395 7:73016619-73016641 ATTTACTAGCAGAACACTGAGGG - Intergenic
1026750046 7:73044762-73044784 ATTTACTAGCAGAACACTGAGGG - Intergenic
1026753694 7:73072872-73072894 ATTTACTAGCAGAACACTGAGGG - Intergenic
1026757345 7:73100908-73100930 ATTTACTAGCAGAACACTGAGGG - Intergenic
1027032498 7:74901177-74901199 ATTTACTAGCAGAACACTGAGGG - Intergenic
1027090059 7:75292578-75292600 ATTTACTAGCAGAACACTGAGGG + Intergenic
1027093704 7:75320506-75320528 ATTTACTAGCAGAACACTGAGGG + Intergenic
1027097347 7:75348473-75348495 ATTTACTAGCAGAACACTGAGGG + Intergenic
1027119644 7:75507558-75507580 ATTTACTAGCAGAACACTGAGGG + Intergenic
1027272181 7:76528053-76528075 ATTTACTAGCAGAACACTGAGGG - Intergenic
1027322000 7:77019199-77019221 ATTTACTAGCAGAACACTGAGGG - Intergenic
1027325634 7:77047119-77047141 ATTTACTAGCAGAACACTGAGGG - Intergenic
1029045271 7:97621344-97621366 ATGTGCTATCAGAAGAGTAAGGG + Intergenic
1029398454 7:100325467-100325489 ATTTACTAGCAGAACACTGAGGG + Intergenic
1029687344 7:102157849-102157871 ATTTGCCTTCAGATTACTCAAGG + Intronic
1029717852 7:102342470-102342492 ATTTACTAGCAGAACACTGAGGG - Intergenic
1029754762 7:102566773-102566795 ATTTACTAGCAGAACACTGAGGG + Intronic
1029772712 7:102665853-102665875 ATTTACTAGCAGAACACTGAGGG + Intronic
1029968275 7:104763395-104763417 ACTTGATTTCAGAAGAAAGAAGG + Intronic
1031003897 7:116450369-116450391 ATTTGCACTCAGAGGAGTGAAGG - Intronic
1031128969 7:117808791-117808813 ATTTGCTTTCAGAGGACTAAAGG + Intronic
1032233983 7:130103647-130103669 ATTTCCCCTCAGAACACTGAAGG - Intronic
1032509758 7:132463353-132463375 ATGTGCTCTAAGAATACTGAGGG - Intronic
1034342106 7:150364058-150364080 ATTTTCTTTCTGCAGAGTGAAGG + Intergenic
1035115435 7:156519446-156519468 ATGTTCTTTGAGAAGACAGATGG + Intergenic
1035745276 8:1957805-1957827 ATTTGCTTTCAGAAGTGAGCTGG + Exonic
1036115904 8:5960643-5960665 ATTTGCTTTCAGAAGCCCAGCGG - Intergenic
1036448575 8:8845059-8845081 ATGTGCATTCAGAATACTGAGGG - Intronic
1039090071 8:33818638-33818660 ATTTGCTTTAATAAGATTGAGGG + Intergenic
1039471855 8:37818360-37818382 ATGTGCTCTCATGAGACTGAAGG - Intronic
1039539044 8:38347210-38347232 ATTTGCTTACAATAGACTGTTGG - Intronic
1040542454 8:48372457-48372479 AGTTGCTTTGAGAACCCTGATGG - Intergenic
1041503378 8:58564477-58564499 ATTTTTCTTCAGAAGACAGATGG - Intronic
1044158795 8:88886420-88886442 ATCTGCTGTCAGATGAGTGATGG + Intergenic
1045042503 8:98239428-98239450 ATTTACTTTCAGAAGGAGGAGGG + Intronic
1046035400 8:108834263-108834285 ATGTGAAATCAGAAGACTGAAGG - Intergenic
1046877095 8:119267343-119267365 ATTTTCTTTCATAAGATTGCTGG - Intergenic
1047594448 8:126364249-126364271 ATTTGCGTTAAGATGACTGGGGG + Intergenic
1051199100 9:14597540-14597562 ATGTGCTTTCAGGAGACCCAGGG + Intergenic
1051966698 9:22836572-22836594 ATCTGCTTTCAGGAGACGAAAGG - Intergenic
1052299866 9:26942045-26942067 ATTTTCTTTCAGAATTGTGATGG - Intronic
1054748222 9:68877503-68877525 AATTGGTTTCAAAAGACTGTAGG + Intronic
1054993017 9:71352321-71352343 AGTTGCTTTAAGAATACTCATGG - Intronic
1055391894 9:75831153-75831175 ATTTGATCTCATAAGACTTATGG - Intergenic
1056066445 9:82940501-82940523 ATTTGCTTTCACAAGACTGGAGG + Intergenic
1056543094 9:87591243-87591265 ACATGCTTTCAGAAGCCTAAGGG - Intronic
1057126796 9:92622829-92622851 ATATGCTTGAAGAAGACAGAAGG + Intronic
1057973726 9:99581636-99581658 ACTTGCTTGTAGAAGACAGAAGG + Intergenic
1058312744 9:103525751-103525773 ATGCTCTTTCAGAAGAGTGATGG - Intergenic
1058656984 9:107231660-107231682 ATTTGCTTTCAGCAAACCAATGG + Intergenic
1058767363 9:108194812-108194834 CTGGGTTTTCAGAAGACTGAGGG - Intergenic
1059312373 9:113397247-113397269 CATTGCTTTCAGGAGGCTGAGGG + Intronic
1059416697 9:114166957-114166979 ATCTGCTATCAGAAGGGTGATGG - Intronic
1059884028 9:118725041-118725063 ATTTGGTATCAGAATAATGATGG + Intergenic
1062058420 9:134481462-134481484 ATTTGCTTTGAGCAAACTGTTGG - Intergenic
1062101025 9:134728658-134728680 ATTCGCTTTCAGTACACGGAAGG + Exonic
1062719597 9:138031255-138031277 ATTTCCTTTGAGAAGACTCATGG + Intronic
1189008872 X:37024997-37025019 ATTTGCTCTAAGATGTCTGAAGG + Intergenic
1190729551 X:53216337-53216359 AGTTGCTTTTTGGAGACTGAGGG + Intronic
1192222782 X:69208688-69208710 TTTTGCTTGGAGAAGACTCAGGG - Intergenic
1194749129 X:97665005-97665027 ATTTGTTTTCAACAGATTGAGGG + Intergenic
1195491573 X:105476450-105476472 ATTTGTTTTCAAATCACTGATGG - Intronic
1195959859 X:110374931-110374953 ATTTCCTTTAAAAAGGCTGAAGG - Intronic
1196970764 X:121105941-121105963 ATTTCCTTCCAACAGACTGAAGG - Intergenic
1197295740 X:124716978-124717000 ATTTGCTTGGAGGAGACTCAAGG - Intronic
1198212247 X:134527248-134527270 ATTTTCCTTCAGAATATTGAAGG + Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1199104868 X:143853596-143853618 TTTTGCTGTCAGAAGCCAGAAGG + Intergenic
1199242685 X:145566350-145566372 ATTTTCTTCCATAAAACTGAAGG - Intergenic
1199708385 X:150450721-150450743 TTTTGCCATCAGAAGAGTGATGG + Intronic
1199988223 X:152967886-152967908 ATTTGCTTACTGTGGACTGAAGG - Intronic
1200816054 Y:7533560-7533582 GTTTGCTTTCAGAAGAATTGTGG - Intergenic
1200877528 Y:8173810-8173832 CTTTGCTTGCAAAAGAATGAGGG + Intergenic
1202015725 Y:20404549-20404571 ATTTTCTGTCAGAAGATTGAAGG + Intergenic