ID: 1156034875

View in Genome Browser
Species Human (GRCh38)
Location 18:32754952-32754974
Sequence GTGTAGATCTGCAGCAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156034870_1156034875 17 Left 1156034870 18:32754912-32754934 CCTGGGGCAAAGATAAAAGAAGA 0: 1
1: 0
2: 1
3: 47
4: 455
Right 1156034875 18:32754952-32754974 GTGTAGATCTGCAGCAAGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156034875 Original CRISPR GTGTAGATCTGCAGCAAGGG AGG Intronic
900038785 1:439798-439820 GAGGAGAAGTGCAGCAAGGGTGG + Intergenic
900060219 1:674777-674799 GAGGAGAAGTGCAGCAAGGGTGG + Intergenic
901447214 1:9315962-9315984 GTGCAGTTCTGCAGCCAGCGGGG + Intronic
904606230 1:31699304-31699326 GTGAATAACTGGAGCAAGGGTGG + Intronic
904979453 1:34484692-34484714 GTTTAGATCAGAAGAAAGGGTGG + Intergenic
906869415 1:49461136-49461158 GTCTAGATCTCTAGCAAGGCTGG + Intronic
907332109 1:53678200-53678222 GCGTGGCTCTACAGCAAGGGTGG - Intronic
907716643 1:56932551-56932573 GGTTAGTTCTGCAGCAAGTGGGG - Intronic
908660540 1:66430749-66430771 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
910039035 1:82825098-82825120 GTGAAGATGTGAAGCAAGGAAGG + Intergenic
910919434 1:92328193-92328215 GTGTAGGTCTCTAGCAAGGCTGG + Intronic
911322571 1:96433204-96433226 GTTTAGATCTCTAGCAAGGCTGG + Intergenic
914455387 1:147832035-147832057 GTCTAGGTCTGTAGCAAGGCAGG + Intergenic
919520421 1:198581543-198581565 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
919609394 1:199726499-199726521 GTGTAGATCTCCTTCAATGGTGG + Intergenic
920850783 1:209626773-209626795 GTGTAGGTCTGCAGCAGGGCAGG - Intronic
920989961 1:210927171-210927193 GTCTAGATCTCTAGCAAGGCTGG - Intronic
921429466 1:215047856-215047878 GGTTAGATCTGTATCAAGGGAGG + Intronic
921948861 1:220908331-220908353 CTGTAGAGCTCCAGAAAGGGTGG - Intergenic
922000032 1:221467883-221467905 GTCTAGATCTGTAGTAAGGCTGG + Intergenic
924880037 1:248151311-248151333 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
1063404857 10:5783976-5783998 GTCTAGATCTCTAGCAAGGCCGG + Intronic
1065072546 10:22040903-22040925 GTGGAGATCTGAGGCAAGTGAGG + Intergenic
1066145380 10:32552958-32552980 GTCTAGATCTTTAGCAAGGCTGG + Intronic
1067549658 10:47225569-47225591 GAGGAGGTCTGCAGCATGGGCGG - Intergenic
1070495145 10:77014889-77014911 GTGCAGGTGTGCAGTAAGGGAGG - Intronic
1071329089 10:84542925-84542947 GTTCAGCTTTGCAGCAAGGGAGG - Intergenic
1072381623 10:94878420-94878442 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
1072583845 10:96764211-96764233 GGGTACATCTGAAGCAAGAGAGG + Intergenic
1076964993 11:75709-75731 GAGGAGAAGTGCAGCAAGGGTGG + Intergenic
1077942407 11:6856944-6856966 GTGTAAATCTGCAGCATGACTGG - Intergenic
1079396148 11:20065601-20065623 GTGCAGAACAGCGGCAAGGGGGG + Intronic
1081658321 11:44872543-44872565 GTCTAGACTTGCAGCAAGGATGG - Intronic
1084092009 11:66884963-66884985 GTGAAGCTCTCCAGCAGGGGTGG - Intronic
1084495847 11:69502612-69502634 GTGGAGCTCTGCAGCCAGAGTGG - Intergenic
1085240384 11:75048972-75048994 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
1087817417 11:102675043-102675065 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
1087907834 11:103720011-103720033 GTCTAGATCTCTAGCAAGGCTGG - Intergenic
1088525834 11:110753360-110753382 GTATAGATCTCTAGCAAGGCTGG + Intergenic
1092464689 12:8720006-8720028 GTGTAGGTGTGCACCAAGGATGG + Intronic
1093604366 12:21072585-21072607 GTCTGGATCTGTAGCAAGGCTGG + Intronic
1093803940 12:23409488-23409510 ATGATGATCTGCAGCAAGGTGGG + Intergenic
1096186039 12:49581157-49581179 ATGTAGAACTGGAGCATGGGAGG + Intronic
1096265690 12:50120753-50120775 GTGCAGCTCTGCATCAAGGAGGG + Intergenic
1099274825 12:80561420-80561442 GTGTATATCTGAAGCAGAGGTGG + Intronic
1100290843 12:93213785-93213807 GTCTAGATCTCTAGCAAGGCCGG + Intergenic
1100885347 12:99063854-99063876 TTGTGCATCTGTAGCAAGGGAGG + Intronic
1100918687 12:99456874-99456896 GTCTAGATCTCTAGCAAGGCTGG - Intronic
1104215163 12:126727092-126727114 GTGCAGATCTGGCGCCAGGGGGG + Intergenic
1107426670 13:40300885-40300907 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
1108298582 13:49051710-49051732 GTCTAGATCTCTAGCAAGGCTGG + Intronic
1108738205 13:53307555-53307577 ATGTAGATCTACAGGAAGTGTGG + Intergenic
1108901037 13:55409237-55409259 GTGTAGATCTCTTGCAAGGCTGG + Intergenic
1109150767 13:58844657-58844679 GTCTAGATCTCTAGCAAGGCTGG - Intergenic
1112945468 13:104921433-104921455 GTCTAGGTCTTCAGCAAGGCTGG - Intergenic
1113415496 13:110125452-110125474 GTGCAGTTCTGCTGCAGGGGTGG + Intergenic
1115393075 14:32876180-32876202 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
1117182359 14:53203781-53203803 GTCTAGATCTCTAGCAAGGCTGG - Intergenic
1118075079 14:62289326-62289348 GTTTAGACCTGCAGAAAGTGAGG + Intergenic
1118748092 14:68788793-68788815 GTGTAGGTCTGCAGGAAGGAAGG - Exonic
1122707633 14:103630984-103631006 GCGTTTATCTCCAGCAAGGGGGG + Intronic
1125798305 15:42421125-42421147 GTGTAAATCTGGAGAAAGAGAGG + Exonic
1126184638 15:45820188-45820210 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
1126490030 15:49226252-49226274 TTGGAGATCTGCAGCAAGAGTGG + Intronic
1126918295 15:53490579-53490601 GTCAAGATCAACAGCAAGGGAGG + Intergenic
1132412717 15:101596574-101596596 GTCTAGATCTCCAGCAAGGCTGG + Intergenic
1132443129 15:101887807-101887829 GAGGAGAAGTGCAGCAAGGGTGG - Intergenic
1134805862 16:17124642-17124664 GTCTAGATCTCTAGCAAGGCTGG + Intronic
1136465161 16:30437731-30437753 CTGGAGATCTGTAGCAGGGGTGG + Intergenic
1139647864 16:68344915-68344937 GTGTAGAGATGCAGGAAGGGAGG - Intronic
1142208192 16:88793832-88793854 GTGTAGCCCTGCTGCAGGGGTGG - Intergenic
1144168771 17:12638182-12638204 CTGTTTATCTGCAGCAAGGCAGG + Intergenic
1147587533 17:41660927-41660949 GTGTGGACATGCAGCCAGGGAGG + Intergenic
1156034875 18:32754952-32754974 GTGTAGATCTGCAGCAAGGGAGG + Intronic
1157402109 18:47397257-47397279 GAATAGATCTGGAGCCAGGGCGG + Intergenic
1158407779 18:57175658-57175680 ATGCAGAGCTGGAGCAAGGGTGG - Intergenic
1158426745 18:57347214-57347236 GTGTGGATTAGCAGAAAGGGTGG + Intergenic
1158884453 18:61812989-61813011 TTGTAATTCTGCAGAAAGGGGGG - Exonic
1159609490 18:70510096-70510118 GAGTGGATCTGCAGGATGGGTGG + Intergenic
1160267474 18:77352810-77352832 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
1160641798 19:145339-145361 GAGGAGAAGTGCAGCAAGGGTGG + Intergenic
1160815485 19:1033839-1033861 GTGTAGACCGGCAGCGTGGGTGG + Intronic
1160815520 19:1033979-1034001 GTGTAGACCGGCAGCGTGGGTGG + Intronic
1160815642 19:1034471-1034493 GTGTAGACCGGCAGCGTGGGTGG + Intronic
1160815659 19:1034541-1034563 GTGTAGACCGGCAGCGTGGGTGG + Intronic
1160815676 19:1034611-1034633 GTGTAGACCGGCAGCGTGGGTGG + Intronic
1160815729 19:1034821-1034843 GTGTAGACCGGGAGCATGGGTGG + Intronic
1161395804 19:4044279-4044301 GTGTGGACCTGCAGCCAGGCAGG - Intergenic
1162532541 19:11244077-11244099 GGGTAGATCTGAAGAATGGGAGG - Intronic
1165104363 19:33460379-33460401 GGGGACATCTGCAGCCAGGGAGG - Intronic
1166248135 19:41545682-41545704 GTGAAGCTCTCCAGCCAGGGAGG + Intergenic
1166571946 19:43802553-43802575 GTGTAGATCTCCAGCAACTGAGG - Intronic
1166742454 19:45122639-45122661 GTGAAGACCTGCAGGCAGGGAGG + Intronic
1167752562 19:51389423-51389445 GTGGAGTTCAGGAGCAAGGGTGG + Exonic
1168061552 19:53895662-53895684 GAGTAGGTCTGCAGAAAGGCTGG - Intronic
926061968 2:9810009-9810031 GTAAAGGTCTGCAGCAAGGATGG + Intergenic
927176627 2:20414228-20414250 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
928782926 2:34847377-34847399 GTCTAGATCTGTAGCAAGGCTGG + Intergenic
929197238 2:39197433-39197455 GTCTAGATCTCTAGCAAGGCCGG - Intronic
929809426 2:45176689-45176711 GAGGGGATCTGCAGTAAGGGTGG + Intergenic
930713940 2:54575023-54575045 GTGAACTTCTGCAGCAAGAGGGG + Intronic
931683980 2:64777407-64777429 ATGTAGATCTGCTGCAATGTCGG - Intergenic
933433329 2:82213593-82213615 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
935600350 2:104915990-104916012 GTGTGCACCTCCAGCAAGGGTGG + Intergenic
937076585 2:119111779-119111801 GAGTAGTTCGGCAGGAAGGGCGG + Intergenic
938175438 2:129122874-129122896 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
939169797 2:138681632-138681654 GTGTGGATTTGCAGCAAGCCGGG + Intronic
941072038 2:160966404-160966426 GTGAAGGTGTGCAGCAGGGGAGG + Intergenic
943149855 2:184098392-184098414 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
945377234 2:209093453-209093475 GTCTAGATCTGTAGCAAGGCTGG + Intergenic
946128588 2:217586442-217586464 GGTGAGAACTGCAGCAAGGGAGG - Intronic
946276632 2:218636533-218636555 GTGTATATCTGCATCCAGGAAGG + Exonic
948331619 2:237171371-237171393 ATATTGGTCTGCAGCAAGGGAGG - Intergenic
1170720875 20:18878153-18878175 GTTTAGATCTCTAGCAAGGCTGG + Intergenic
1170741198 20:19058043-19058065 GTCTAGATCTTTAGCAAGGCTGG - Intergenic
1172851285 20:37967967-37967989 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
1173793051 20:45840624-45840646 GTGTAGAGCTGCAGGGAGGGTGG - Exonic
1177195379 21:17899352-17899374 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
1181591641 22:23889199-23889221 TTGGAGGTCTGCAGCCAGGGCGG - Intronic
1181703140 22:24632133-24632155 AAGTAGACCTGCAGCCAGGGTGG + Intergenic
1181823970 22:25498513-25498535 ATGTAGATTTGGAGTAAGGGGGG - Intergenic
1183112452 22:35660294-35660316 GTGTAGGTGTGCAGCAGGGGTGG - Exonic
1184713036 22:46264091-46264113 GTGTAGACCTGTAGTATGGGAGG - Intergenic
1184755948 22:46515799-46515821 CTGGAGATCTGCAGGATGGGCGG - Intronic
950560252 3:13717105-13717127 GTGCAGATGAGCAGCATGGGGGG + Intergenic
952627501 3:35424687-35424709 GTGTGGCGCTGCAGAAAGGGAGG + Intergenic
953076131 3:39572166-39572188 GTGTGGATCTGAAGTATGGGTGG - Intergenic
953276855 3:41509427-41509449 GTCTAGATCTCTAGCAAGGCTGG - Intronic
955461472 3:59188536-59188558 GTCTAGATCTCTAGCAAGAGCGG + Intergenic
956995544 3:74823424-74823446 GTCTAGATCTCTAGCAAAGGTGG + Intergenic
957038846 3:75320621-75320643 GTCAAGATCTGCACCAAGGACGG + Intergenic
958509962 3:95035741-95035763 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
960756608 3:121020365-121020387 GTCTAGATCTCTAGCAAGGCTGG - Intronic
961216033 3:125161375-125161397 GTGTAGCTCAGAAGCAAAGGAGG + Intronic
962995015 3:140618062-140618084 GTCTAGATCTCTAGCAAGGCTGG - Intergenic
963494831 3:146045637-146045659 GTAGAAATCTGCTGCAAGGGTGG - Intergenic
963585116 3:147176646-147176668 GTCTAGATCTCTAGCAAGGCAGG - Intergenic
964299498 3:155272210-155272232 GTCTAGATCTCTAGCAAGGCTGG - Intergenic
964393295 3:156219561-156219583 GTCTAGATCTCTAGCAAGGCTGG - Intronic
965296510 3:166954478-166954500 GTGTAGATCTCTGGCAAGGCTGG + Intergenic
965733610 3:171798313-171798335 GAGTTGATGTGAAGCAAGGGAGG - Intronic
966870165 3:184285139-184285161 GTGGAGGTCTCCAGCAAGGCTGG + Intronic
969060024 4:4426917-4426939 GTGGAGTTCTGCAGCCAGGCAGG - Intronic
970283097 4:14479668-14479690 GTCTAGATCTGTAGCAAGGCTGG - Intergenic
971138172 4:23893045-23893067 GTGTAGATATGCAACATTGGGGG - Intronic
973675906 4:53262790-53262812 GTCTAGATCTGTAGCCAGGCTGG + Intronic
977489387 4:97692648-97692670 GTCTAGATCTCTAGCAAGGCTGG - Intronic
980860929 4:138498890-138498912 GTCTAGATCTCTAGCAAGGCAGG + Intergenic
981167834 4:141582650-141582672 GTCTAGATCTCTAGCAAGGCTGG - Intergenic
981376856 4:144025801-144025823 GTCTAGGTCTCCAGCAAGGCTGG - Intergenic
981796397 4:148600043-148600065 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
981824986 4:148929713-148929735 GTCTAGGTCTCCAGCAAGGCTGG - Intergenic
981941295 4:150284132-150284154 CTGTAGATATGCAGCCAGGAAGG + Intronic
984234431 4:177138502-177138524 GTCTAGATCTCTAGCAAGGCTGG - Intergenic
988002350 5:25364344-25364366 GTCTAGATCTCCAGCATGGCCGG - Intergenic
989148237 5:38270005-38270027 GTCTAGCTCTGCAGCCAGGAGGG + Intronic
989562640 5:42869719-42869741 GTCTAGATCTCTAGCAAGGCTGG + Intronic
989694263 5:44181490-44181512 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
990338686 5:54801222-54801244 GTGTACATATGCGGTAAGGGAGG - Intergenic
990712684 5:58603352-58603374 GTCTAGATCTCTAGCAAGGCTGG + Intronic
992599709 5:78386993-78387015 GTCTAGATCTCTAGCAAGGCCGG + Intronic
992898784 5:81271566-81271588 GTCTAGATCTCTAGCAAGGCAGG - Intergenic
993646341 5:90468231-90468253 GTCTAGATCTCTAGCAAGGCTGG + Intronic
993883744 5:93393647-93393669 GTGTAGGTCTCTAGCAAGGCTGG + Intergenic
994496699 5:100521496-100521518 GTCTAGATCTCTAGCAAGGCTGG - Intergenic
994636231 5:102346950-102346972 GTCTAGATCTCTAGCAAGGCTGG - Intergenic
1002735062 5:181379145-181379167 GAGGAGAAGTGCAGCAAGGGTGG - Intergenic
1002749464 6:94977-94999 GAGGAGAAGTGCAGCAAGGGTGG + Intergenic
1003801192 6:9669270-9669292 GTGAAGATCTGCAGGAGAGGTGG - Intronic
1006784121 6:36653532-36653554 GGGAGGATCTGGAGCAAGGGCGG - Intergenic
1007167142 6:39836728-39836750 GTGGAGATTTGCAGCCAGGTCGG - Intronic
1008042146 6:46814089-46814111 GTCTAGATCTCTAGCAAGGCTGG + Intronic
1008115659 6:47546452-47546474 GTCTAGGTCTGTAGCAAGGCTGG - Intronic
1008256282 6:49303927-49303949 GTCTAGATCTCTAGCAAGGCTGG - Intergenic
1009589258 6:65644517-65644539 GTCTAGATCTCTAGCAAGGCTGG - Intronic
1009800110 6:68526651-68526673 GTCTAGATCTCAAGCAAGGCTGG + Intergenic
1011005393 6:82638713-82638735 GTCTAGCTCTGTAGCAAGGTAGG - Intergenic
1012173292 6:96046557-96046579 GTGTAGGTCTTCAGGATGGGTGG - Intronic
1014147645 6:118016485-118016507 GTCTAGTTCATCAGCAAGGGTGG + Intronic
1014304690 6:119726347-119726369 GTGTAGGTCTCTAGCAAGGCCGG + Intergenic
1015565727 6:134568501-134568523 GTCTAGGTCTCCAGCAAGGCTGG - Intergenic
1015877819 6:137841907-137841929 GTCTAGATCTCCAGCAAGGCTGG + Intergenic
1016216182 6:141606802-141606824 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
1017190340 6:151647230-151647252 GTCTAGGTCTGTAGCAAGGCTGG + Intergenic
1017556158 6:155571818-155571840 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
1018234746 6:161713258-161713280 ATGTAGAGATGCTGCAAGGGTGG - Intronic
1018345373 6:162893559-162893581 GTGTAGATCTGGGGCACGCGTGG - Intronic
1018755422 6:166844373-166844395 GTCTAGATCTCTAGCAAGGCTGG - Intronic
1019239321 6:170651462-170651484 GAGGAGAAGTGCAGCAAGGGTGG - Intergenic
1020050837 7:5080546-5080568 GTAGACATCAGCAGCAAGGGGGG + Intergenic
1021207103 7:17795450-17795472 GTGAAGATCTGAAGGAAGTGAGG - Intronic
1021473951 7:21039248-21039270 GTCTAGGTCTCCAGCAAGGCTGG + Intergenic
1023183094 7:37505552-37505574 GTGTGCATGTGCAACAAGGGGGG + Intergenic
1023970301 7:44986204-44986226 GTGTAGACCTGCCGCAAGAGAGG - Intergenic
1024081649 7:45861611-45861633 GTTTAGATCTGCAGGGTGGGTGG - Intergenic
1024665475 7:51542909-51542931 ATGTAGATCTCTAGCAAGGCTGG + Intergenic
1024745219 7:52398830-52398852 GTCTAGGTCTGTAGCAAGGCTGG + Intergenic
1027554731 7:79648709-79648731 GAGCAGATCTGCAGAAAGAGAGG - Intergenic
1028331187 7:89594149-89594171 ATGTAGCTCTGAGGCAAGGGCGG - Intergenic
1028426484 7:90695696-90695718 GTGTAGATGTGAAAGAAGGGAGG + Intronic
1028529503 7:91823480-91823502 GTCTAGATCTTTAGCAAGGCAGG + Intronic
1028993312 7:97074032-97074054 GTCTAGGTCTCCAGCAAGGCTGG + Intergenic
1030533597 7:110738673-110738695 GTCTAGATCTCTAGCAAGGCTGG - Intronic
1031655333 7:124348351-124348373 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
1033843737 7:145406463-145406485 GAGTAGACCAGAAGCAAGGGAGG + Intergenic
1034943439 7:155246873-155246895 GTTTGGATATGCAGCATGGGGGG + Intergenic
1035481666 7:159191909-159191931 GTGAAGCTCTGCAGCAAGTGAGG - Intergenic
1035508449 8:155146-155168 GAGGAGAAGTGCAGCAAGGGTGG + Intergenic
1038908902 8:31939016-31939038 GTCTAGATCTTTAGCAAGGCCGG - Intronic
1043876286 8:85490507-85490529 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
1047607141 8:126486778-126486800 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
1049565718 8:143337676-143337698 GTGTACACCTGTAGTAAGGGAGG + Intronic
1055156458 9:73068169-73068191 GTTTAGATCTCTAGCAAGGCTGG - Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1059673922 9:116518110-116518132 GTGTAGACCTCTAGCAAGGCTGG - Intronic
1062759529 9:138331753-138331775 GAGGAGAAGTGCAGCAAGGGTGG - Intergenic
1203599976 Un_KI270748v1:2525-2547 GAGGAGAAGTGCAGCAAGGGTGG - Intergenic
1188606802 X:32041313-32041335 GTGGAGATCACCAGGAAGGGGGG - Intronic
1189668431 X:43382039-43382061 GTCTAGATCTCTAGCAAGGCCGG - Intergenic
1190310980 X:49116931-49116953 TTTTAGATCTGCAGCAGGGAGGG - Intronic
1191077155 X:56467611-56467633 GTATAGATCTCTAGCAAGGCTGG + Intergenic
1192991715 X:76466408-76466430 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
1193077156 X:77366121-77366143 GTGTTGCTCTGTAGCAAGGCTGG - Intergenic
1193255512 X:79343801-79343823 GTCTAGATCTCTAGCAAGGCTGG - Intergenic
1193775809 X:85640769-85640791 GTCTAGATCTCTAGCAAGGTTGG + Intergenic
1194381245 X:93193748-93193770 GTTTAGATCTCTAGCAAGGCTGG - Intergenic
1194532951 X:95073176-95073198 GTTTAGATCTCTAGCAAGGATGG - Intergenic
1194967495 X:100305026-100305048 GTCTAGATCTCTAGCAAGGCTGG - Intronic
1195972673 X:110490788-110490810 GTCTAGATCTCTAGCAAGGCTGG + Intergenic
1196225029 X:113156764-113156786 GTGTAGGTCTCTAGCAAGGCTGG + Intergenic
1196590348 X:117480384-117480406 GTCTAGGTCTTCAGCAAGGCTGG + Intergenic
1196675601 X:118417721-118417743 GTCTAGATCTCGAGCAAGGCCGG + Intronic
1197132554 X:123021285-123021307 GTGTAGATCTCTAGCAAAGCTGG - Intergenic
1197515390 X:127421821-127421843 GTCTAGATATCCAGCAAGGATGG + Intergenic
1199913811 X:152316461-152316483 GTCTAGATCTCTAGCAAGGCTGG - Intronic
1200414996 Y:2900274-2900296 GTGTAGGTCTCTAGCAAGGCTGG - Intronic
1201307876 Y:12566617-12566639 GTCTAGGTCTGTAGCAAGGCTGG + Intergenic