ID: 1156047184

View in Genome Browser
Species Human (GRCh38)
Location 18:32889915-32889937
Sequence GTTAATGCACAGCTTCCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156047179_1156047184 15 Left 1156047179 18:32889877-32889899 CCAAACTGGAAGGGGCACAGGAA No data
Right 1156047184 18:32889915-32889937 GTTAATGCACAGCTTCCTATTGG No data
1156047178_1156047184 16 Left 1156047178 18:32889876-32889898 CCCAAACTGGAAGGGGCACAGGA No data
Right 1156047184 18:32889915-32889937 GTTAATGCACAGCTTCCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156047184 Original CRISPR GTTAATGCACAGCTTCCTAT TGG Intergenic
No off target data available for this crispr