ID: 1156050203

View in Genome Browser
Species Human (GRCh38)
Location 18:32923612-32923634
Sequence TGCATTGGTGTACTATTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156050203_1156050207 5 Left 1156050203 18:32923612-32923634 CCAGTCAATAGTACACCAATGCA No data
Right 1156050207 18:32923640-32923662 TTTTTATAAATTCTTTTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156050203 Original CRISPR TGCATTGGTGTACTATTGAC TGG (reversed) Intergenic
No off target data available for this crispr