ID: 1156053911

View in Genome Browser
Species Human (GRCh38)
Location 18:32974577-32974599
Sequence CTGAGAGTCTGTCTGGAAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 239}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156053908_1156053911 8 Left 1156053908 18:32974546-32974568 CCTGCACAGCTAATATTTTCTGA 0: 1
1: 0
2: 1
3: 31
4: 280
Right 1156053911 18:32974577-32974599 CTGAGAGTCTGTCTGGAAGTTGG 0: 1
1: 0
2: 0
3: 18
4: 239
1156053906_1156053911 22 Left 1156053906 18:32974532-32974554 CCTGCAATCACCTACCTGCACAG 0: 1
1: 1
2: 0
3: 11
4: 135
Right 1156053911 18:32974577-32974599 CTGAGAGTCTGTCTGGAAGTTGG 0: 1
1: 0
2: 0
3: 18
4: 239
1156053907_1156053911 12 Left 1156053907 18:32974542-32974564 CCTACCTGCACAGCTAATATTTT 0: 1
1: 0
2: 16
3: 789
4: 19103
Right 1156053911 18:32974577-32974599 CTGAGAGTCTGTCTGGAAGTTGG 0: 1
1: 0
2: 0
3: 18
4: 239
1156053904_1156053911 30 Left 1156053904 18:32974524-32974546 CCTACTTCCCTGCAATCACCTAC 0: 1
1: 0
2: 1
3: 25
4: 218
Right 1156053911 18:32974577-32974599 CTGAGAGTCTGTCTGGAAGTTGG 0: 1
1: 0
2: 0
3: 18
4: 239
1156053905_1156053911 23 Left 1156053905 18:32974531-32974553 CCCTGCAATCACCTACCTGCACA 0: 1
1: 0
2: 6
3: 12
4: 209
Right 1156053911 18:32974577-32974599 CTGAGAGTCTGTCTGGAAGTTGG 0: 1
1: 0
2: 0
3: 18
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156053911 Original CRISPR CTGAGAGTCTGTCTGGAAGT TGG Exonic
900625110 1:3604395-3604417 CTGCCGGTCTGTCTGGGAGTTGG - Intronic
901204783 1:7487962-7487984 CTGAGAGGCTGTGTGGGAGGTGG - Intronic
902562761 1:17288086-17288108 CAGAGATTCTGTCTGGACATTGG + Intergenic
902693484 1:18125126-18125148 CTGAGAGCCTGTGTGGCAGGGGG - Intronic
905764404 1:40588130-40588152 CTTAAAGTCTGTCTGGGAATAGG - Intergenic
908126822 1:61040395-61040417 CTGGGAGTCTGTATAAAAGTTGG + Intronic
908186160 1:61654943-61654965 CTGGGGGTGTGTCTGAAAGTGGG - Intergenic
908466960 1:64405803-64405825 CTGAGGGTGTTTCTGGAATTTGG - Intergenic
909759441 1:79270441-79270463 CTGAGAATGTGTCCGGAACTTGG - Intergenic
910276146 1:85451182-85451204 CTGAGATTCTGTCCAGCAGTTGG - Intronic
911691721 1:100842234-100842256 CTGTGAATCTGTCTGGTACTAGG + Intergenic
913139796 1:115929575-115929597 CTGACATTCTGCCTGGAAGTAGG + Intergenic
913391470 1:118317923-118317945 CTGCCAGACTGTCTGGGAGTGGG - Intergenic
915585822 1:156843410-156843432 CTGATAGTAGGTCTGGGAGTGGG - Exonic
918329402 1:183443109-183443131 CTTAGATTCTTTTTGGAAGTAGG - Intergenic
919816468 1:201443897-201443919 CTGAGTGTCTCTGTGGAACTAGG - Intergenic
919840456 1:201605513-201605535 CTGACAGTCTGTCTGTGTGTGGG + Intergenic
1063393049 10:5662515-5662537 CTGAGACTCTGTCGAGAAGGGGG + Intronic
1064051647 10:12065000-12065022 CTGAGATTTTGTATGGAAGGTGG - Intergenic
1065098151 10:22303095-22303117 CTCAGTAACTGTCTGGAAGTAGG - Intergenic
1065960483 10:30730591-30730613 ATGAGAATCTGGCTAGAAGTTGG + Intergenic
1067935205 10:50605289-50605311 ATGACATTCTGTTTGGAAGTGGG - Intronic
1068472840 10:57487002-57487024 CTGAGAATCTGTCTGGTCCTGGG + Intergenic
1070434740 10:76379335-76379357 CTGTGAATCTGTCTGGTCGTGGG + Intronic
1070450016 10:76548693-76548715 CTGAGAATCTTTCTGTCAGTTGG + Intronic
1070842836 10:79499826-79499848 CTGAGTGTCTGTCAAGAAGTCGG + Intergenic
1071599103 10:86947865-86947887 CTGAGAAACTGACTGGAAGCTGG - Intronic
1072611220 10:97018738-97018760 CTGAGGGTCTGGCTGGCTGTTGG - Intronic
1073481719 10:103790083-103790105 CTGAGAGTGTGCCTGGAGGGAGG - Intronic
1073962684 10:108952058-108952080 CTGTGAATCTGTCTGGACCTGGG - Intergenic
1076399846 10:130175189-130175211 CTGAGAGTCAGGCTGGAAACAGG - Intronic
1077648469 11:3947777-3947799 GTGAAAGTAGGTCTGGAAGTAGG - Intronic
1078034107 11:7784669-7784691 CTGTGAATCTGTCTGGTACTGGG - Intergenic
1078091642 11:8268044-8268066 CTGGGAGACTGGCTGGCAGTGGG + Intronic
1080746810 11:35115657-35115679 CTGAGAGTGTGTCTGGCAGGTGG - Intergenic
1081559439 11:44199528-44199550 CTGAGAGTCTCTCTGAAAGCTGG - Intronic
1081744870 11:45465811-45465833 CTGAGAGTCTGGTGGTAAGTTGG - Intergenic
1082888235 11:58110920-58110942 CTGGGAGGCTGTCTGGAATCAGG + Intronic
1083923968 11:65794894-65794916 TTGAGAGTCACTCGGGAAGTTGG + Intronic
1084034060 11:66497325-66497347 CTGAGAGTCTTGCTGGAGGCTGG + Exonic
1085296364 11:75433952-75433974 CTGAGAGTCTGCCTGGTCATGGG - Intergenic
1085434421 11:76486681-76486703 TTCAGAGTCTGTCTGGAAGGTGG + Intronic
1086558558 11:88140848-88140870 TTGAGTGTCTGTATGGATGTAGG + Intronic
1087079315 11:94154579-94154601 CTGATGGTGTGTCTGGAAGCAGG - Intronic
1089072920 11:115715265-115715287 CTGAGGGTGTGTGTGAAAGTGGG + Intergenic
1090933901 11:131324702-131324724 GTGAGAGTCTGTGTGGAGGGTGG + Intergenic
1092475485 12:8815448-8815470 CTGATAACCTGTCTGGAATTTGG - Intergenic
1093745702 12:22739121-22739143 CTGAGACTCTGTTGGGAAGGTGG - Intergenic
1093928478 12:24932027-24932049 TTGAGAGGCTGTCAGGAAGTTGG + Intronic
1094008389 12:25780656-25780678 CTTGTAGTCTTTCTGGAAGTGGG + Intergenic
1095964371 12:47857182-47857204 CTGGGAGTGTGTCTGGAGTTGGG + Exonic
1096543277 12:52320562-52320584 CTGGAAAACTGTCTGGAAGTGGG - Intronic
1096961339 12:55581106-55581128 TTGAGTGTCTGTCTAGAAGTTGG + Intergenic
1097159521 12:57036484-57036506 CTGAGACTGTAGCTGGAAGTTGG + Intronic
1097408051 12:59215444-59215466 CTGACAGTCTGTAAGGAAATGGG + Intergenic
1099699463 12:86065091-86065113 CTGTGAATCTGTCTGGTCGTGGG - Intronic
1103900576 12:124301719-124301741 CTGAGTGTCTGGGGGGAAGTGGG + Intronic
1104047665 12:125174479-125174501 CGGAGAGCCAGGCTGGAAGTGGG + Intergenic
1104367317 12:128189818-128189840 GTTAGAGTATGTCTGGATGTCGG + Intergenic
1104902086 12:132194971-132194993 CTGTGAGTCTGGCTGGGGGTGGG + Intergenic
1105932401 13:25065162-25065184 ATGAGATTCCCTCTGGAAGTTGG + Intergenic
1106305011 13:28501678-28501700 CTGAGGGTGTGTCTGGAGTTCGG - Intergenic
1106611981 13:31292421-31292443 CTGTGAGTCTGTCTGGTTCTGGG + Intronic
1106690631 13:32111574-32111596 TTGAGAATCTGTCAGGAAGAAGG + Intronic
1107904098 13:45046415-45046437 CGGAGAGTCATTCTGGAACTTGG + Intergenic
1108485982 13:50925628-50925650 TTTACAGTCTGTCTGGGAGTAGG + Intronic
1109394644 13:61740146-61740168 CTGAGATTCTCTGTGGAAGGTGG - Intergenic
1109439497 13:62350563-62350585 CTGTGAATCTGTCTGGCATTGGG + Intergenic
1110063192 13:71067492-71067514 CAGAGACTCTTTCTGGAAGGAGG - Intergenic
1110816618 13:79867342-79867364 CTTAGATTCTGTTTGGAATTTGG + Intergenic
1111286813 13:86104606-86104628 CTGTGACTCTGTCTGGTACTGGG + Intergenic
1112136282 13:96581855-96581877 CTGAGAGTTTGTACTGAAGTGGG + Intronic
1112695440 13:101943221-101943243 CTGAGAGTCAGTATGGAACCCGG - Intronic
1113292005 13:108917411-108917433 CTGGGAGTCTTTCAGGTAGTTGG - Intronic
1114151301 14:20042621-20042643 CTGGGAGGCTGTCTTGAAGCCGG + Intergenic
1114665371 14:24374419-24374441 CTTGGAGTCTGGCAGGAAGTTGG - Exonic
1114752241 14:25217966-25217988 CTGTGAGCCTTCCTGGAAGTTGG + Intergenic
1114981857 14:28174551-28174573 CTGAGAACCTGTTTGGAAGGAGG + Intergenic
1117238307 14:53801707-53801729 CTGTGAGTCTGTCTGGTCCTAGG - Intergenic
1117336766 14:54762613-54762635 CTGTGGGTCTCTCAGGAAGTAGG - Intronic
1119872816 14:78031545-78031567 CTGAGAATGTGTCCTGAAGTTGG + Intergenic
1127717323 15:61661856-61661878 CTGAGAGTCAGTGTGGGAGGAGG - Intergenic
1129389733 15:75214572-75214594 CTGAGGGGGTGTCTGGAGGTGGG - Intergenic
1129521551 15:76189579-76189601 CTGAGAGTCTGGGAGGAAGGGGG + Intronic
1130879419 15:88042430-88042452 GGCAGAGTCTGTCTGGAAGCCGG - Intronic
1131848041 15:96508924-96508946 CAGAGAGTCTCCCTGGAAATTGG + Intergenic
1133001458 16:2853558-2853580 CTCAGGGGCTGTCTGGAAGACGG - Intronic
1133706835 16:8362882-8362904 CTGAGAGTCAGTCTCCATGTAGG - Intergenic
1133952807 16:10411321-10411343 CTGTGAGTCTGTCTGGTACTGGG + Intronic
1134205839 16:12237322-12237344 CTGTGCCTCTGTCTGGGAGTGGG + Intronic
1134763981 16:16739736-16739758 CTGAGACTCTGTCTCGAAGAGGG - Intergenic
1134982073 16:18619425-18619447 CTGAGACTCTGTCTCGAAGAGGG + Intergenic
1135787338 16:25361794-25361816 CTGATGGTCTGTCTGAAGGTTGG + Intergenic
1137068519 16:35877104-35877126 CTCAGTGTCTGGCTGGCAGTGGG - Intergenic
1137632915 16:49960090-49960112 ATGAGGGTTTGTGTGGAAGTGGG - Intergenic
1138201518 16:55091869-55091891 CTGAGAGGCTGTGTGGAACGGGG + Intergenic
1138810164 16:60139901-60139923 CCGAAGGTCTGCCTGGAAGTGGG + Intergenic
1141154556 16:81588100-81588122 CTGAGACACTGTGTGGAAGGAGG + Intronic
1143331781 17:6142375-6142397 CTAACAGTCTCTCTGGAAGATGG - Intergenic
1143379166 17:6485058-6485080 CTGACCTGCTGTCTGGAAGTCGG - Intronic
1143591653 17:7888706-7888728 CTGAGAGTGTGTGTGGGTGTGGG + Intronic
1153534612 18:6087485-6087507 CTCAGAGTCTGAGTGGAGGTGGG + Intronic
1155534503 18:26803020-26803042 CTAAGGCTCTTTCTGGAAGTTGG + Intergenic
1156053911 18:32974577-32974599 CTGAGAGTCTGTCTGGAAGTTGG + Exonic
1156468072 18:37360617-37360639 CTCAGAGCCTGTCTGGAGGCAGG + Intronic
1157043579 18:44068141-44068163 CAGAATGTCTGTCTGGAAGATGG - Intergenic
1157168148 18:45377439-45377461 CTGAGAGTTTATTTGGCAGTTGG - Intronic
1157265798 18:46220308-46220330 CTGAGATTTTGTCTTGAAGTGGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158619793 18:59023054-59023076 CTGAGAGCCTGGATGGAACTTGG + Intergenic
1162000821 19:7743937-7743959 CTGCCATGCTGTCTGGAAGTGGG + Intronic
1165537411 19:36461033-36461055 CTCAGAGTCTGTGTGAGAGTAGG + Intronic
1165915230 19:39254522-39254544 ATGAGAGTCTGTCTTGAAATTGG + Intergenic
1166305275 19:41934026-41934048 CTGAGAACCTGCCAGGAAGTGGG + Intergenic
1168209196 19:54877210-54877232 CTGTGAGTCTGTCTGGTACTGGG + Intronic
928100452 2:28434352-28434374 CTGGGAGGCTTTCTGGAGGTAGG + Intergenic
929000682 2:37344707-37344729 CTCCGAGTCTGTCTGGGAGCGGG - Exonic
929765090 2:44837620-44837642 CTGAGGGGCTGTCTGGGAGGTGG + Intergenic
930137541 2:47917428-47917450 GTCAGAGGCTGTCTTGAAGTGGG - Intergenic
930440209 2:51395019-51395041 CTGCGAATCTGTCTGGTAATGGG - Intergenic
931581092 2:63775672-63775694 CTTAGAGTCTTTCTGGAACAAGG + Intronic
932995260 2:76844145-76844167 GTGAGAGTCTGTCTTGAGGCAGG - Intronic
934113879 2:88765871-88765893 CTGAGAGTCTGTGCGAAGGTAGG + Intergenic
935302920 2:101709109-101709131 CTGAGTGACTGTCTGGATGAGGG + Intronic
938994711 2:136665945-136665967 TGGAGATTCTGTCTGGACGTGGG - Intergenic
939958904 2:148549108-148549130 CTGAGAGGCTGGCGGGAATTGGG - Intergenic
940112399 2:150169286-150169308 ATGAGAGGCTGTCTGCAAGCTGG + Intergenic
940168401 2:150800356-150800378 ATGATAGGCTGTCTGGAAGCTGG - Intergenic
940406587 2:153310708-153310730 CTGAGAGTCAGTATAGCAGTAGG - Intergenic
941441158 2:165538493-165538515 GTGAGAGACTGGATGGAAGTGGG - Intronic
942117035 2:172738129-172738151 TTGAGAGTGTTTATGGAAGTTGG + Intronic
942208213 2:173644835-173644857 CTCAGAGTCTGTCAGCAAGCTGG + Intergenic
942879199 2:180838874-180838896 CTGAGGGTCTGTCTGTTAGAAGG - Intergenic
946500150 2:220238623-220238645 CAGAGAGTTTTTCTGGAAATTGG + Intergenic
946924566 2:224614076-224614098 ATGAGAGTCTGTCTGGTAATTGG + Intergenic
946976390 2:225157020-225157042 CTGACAGTCTTTCTGGAAATTGG + Intergenic
947131330 2:226929033-226929055 CTGTGAATCTGTCTGGCACTGGG - Intronic
947615634 2:231555183-231555205 CAGAGTGTCTGACTGGAAGCAGG + Intergenic
948051491 2:234982561-234982583 CTGAGAGTCTGGGTGGCAGGTGG + Intronic
948068994 2:235104683-235104705 GTGTGAGTCTGCCTGCAAGTGGG - Intergenic
948255262 2:236563811-236563833 TTGAGAGACTGTCTGTAGGTGGG + Intergenic
948546439 2:238733331-238733353 TTTATAGTCAGTCTGGAAGTTGG + Intergenic
1169197949 20:3693426-3693448 CTGTGAGTCTGGCTGGATGCAGG - Exonic
1171143856 20:22765043-22765065 CTGAGATGCTGTCTTGGAGTTGG + Intergenic
1177450745 21:21262237-21262259 CTGTGAATCTGTCTGGTCGTGGG - Intronic
1177899123 21:26891847-26891869 ATGATAGGCTGTCTGCAAGTTGG - Intergenic
1180010791 21:45049929-45049951 CTGTGAGCCTCTCTGGAAGCAGG - Intergenic
1180792409 22:18582952-18582974 CGGAGGTTCTCTCTGGAAGTTGG + Intergenic
1181229328 22:21412366-21412388 CGGAGGTTCTCTCTGGAAGTTGG - Intergenic
1181249322 22:21522497-21522519 CGGAGGTTCTCTCTGGAAGTTGG + Intergenic
1181992663 22:26849356-26849378 CTAGGAGTATGTGTGGAAGTGGG + Intergenic
1182451089 22:30422344-30422366 CTGAGGCTTTGTCTGGAAGCAGG - Exonic
1183331550 22:37224818-37224840 CTGAGAGCCTGGCGGGAATTTGG - Intergenic
1184919069 22:47592943-47592965 CCGGGCGTCTGTCTGGAAGATGG + Intergenic
949592921 3:5512357-5512379 CTGTGAATCTGTCTGGTATTGGG - Intergenic
950003762 3:9678012-9678034 CAGAGAGTGAGTCAGGAAGTCGG - Exonic
950813800 3:15676541-15676563 CTGTCAGTCTATCTGGAGGTTGG + Intronic
953431482 3:42844206-42844228 CTAACAGTTTATCTGGAAGTTGG + Intronic
954566730 3:51606311-51606333 CAGAGAGACTATGTGGAAGTTGG + Intronic
955040827 3:55316347-55316369 GTGAGAGACTGGCTGGAGGTAGG - Intergenic
955236523 3:57144393-57144415 CTGATAGGCTGTCAGGAAGATGG - Intronic
955453640 3:59097124-59097146 CTGTGAGTCTGTCTGGTCTTGGG + Intergenic
956432168 3:69198109-69198131 GTAAGACTCTGTCTGGCAGTTGG + Intronic
957878931 3:86184845-86184867 CTGAGATTCTTTCTTGAGGTTGG - Intergenic
958562016 3:95759462-95759484 CTGTGAGTCTGTCTGAGACTGGG + Intergenic
960229061 3:115203265-115203287 CTGGGACTCTGACAGGAAGTGGG + Intergenic
963222209 3:142825245-142825267 CCGAAGGTCAGTCTGGAAGTGGG + Intronic
963244908 3:143048790-143048812 CTGGGAGACTGTCTGGGAGGCGG + Intronic
964297970 3:155254595-155254617 CTGAGAGTGTGGGTGGAAGAAGG - Intergenic
967749500 3:193097781-193097803 CTGAAAATCTGTTTGGAACTGGG - Intergenic
967830735 3:193917617-193917639 CTGAAAACCTGTCTGGAAATAGG + Intergenic
968633219 4:1663359-1663381 ATGAGTTTCTGTGTGGAAGTAGG - Intronic
970744573 4:19279861-19279883 CTGAGAGTCTGTCATCTAGTGGG + Intergenic
972136006 4:35895059-35895081 CTGTGAATCTGTCTGGTCGTAGG - Intergenic
972755139 4:42038733-42038755 CTCAGATCCTTTCTGGAAGTAGG + Intronic
973140811 4:46765871-46765893 GTGAGAGTCAGCCTGGAACTGGG - Intronic
973284473 4:48400113-48400135 CTGTGAATCTGTCTGGTATTGGG + Intronic
975360941 4:73471185-73471207 CTGTGAGTCTGTCTGGTCCTGGG + Intergenic
979524300 4:121701544-121701566 CTGAGAGACTGGCTGGCAATAGG - Intergenic
982899949 4:160986085-160986107 CTGAGAGTCTGACTGGGGGAAGG - Intergenic
984022168 4:174498807-174498829 TTGAGAGTCAGTTTGCAAGTTGG - Intronic
984034274 4:174646807-174646829 CTGAGAGTCTGTATGACAATTGG + Intronic
986019600 5:3788915-3788937 CAGAGAGTGTGTGTGGAACTAGG + Intergenic
988785666 5:34563841-34563863 CTGAGATCCTCTCTGGAGGTAGG + Intergenic
989523173 5:42424208-42424230 GTGTGTGTGTGTCTGGAAGTTGG + Intronic
990487508 5:56273731-56273753 CTTAGAGTGTGACTGGAGGTTGG - Intergenic
996271111 5:121605682-121605704 CTGAGAATCTGTCTGGTCCTGGG - Intergenic
997207803 5:132060216-132060238 ATGAGAGTTTGTCTGGTAGCCGG - Intergenic
997217200 5:132122665-132122687 CTCAGGGCCTGTCGGGAAGTTGG + Intergenic
997810970 5:136969590-136969612 CTGATCTTCTGTCTGGAAGTGGG + Intergenic
999156951 5:149464885-149464907 GTGAGGGTCTGGCTGGAAGATGG - Intergenic
1000646021 5:163761153-163761175 CAGAGAGTCTTCCTGGAAATAGG - Intergenic
1003962790 6:11224556-11224578 CTGAGAGTTTGGCAGGAAATGGG - Intronic
1005853242 6:29838802-29838824 ATGATAGACTGTCTGGAAGCTGG + Intergenic
1009738892 6:67718200-67718222 CTGAGAGTGGGGCTGGAAGATGG + Intergenic
1010252878 6:73726844-73726866 GTGAGAGGCTGTCTGAAAGCAGG - Intronic
1014288400 6:119529514-119529536 CTGGGATTCTATCTGGAACTTGG + Intergenic
1014446843 6:121537793-121537815 CTGAGAGTTTGTCTTAAAATAGG - Intergenic
1014583796 6:123171952-123171974 CTCAGATTCCGTCTGGAACTTGG - Intergenic
1014782829 6:125584552-125584574 CAGACAGTCTGTCTAGAGGTAGG - Intergenic
1015386391 6:132629042-132629064 CTGTGAATCTGTCTGGACCTGGG + Intergenic
1015501089 6:133934215-133934237 CTGTGACTCTGTCTGGACTTGGG - Intergenic
1015574562 6:134657474-134657496 TTAAGTGTCTGGCTGGAAGTAGG - Intergenic
1016569271 6:145494094-145494116 CTGACAATCTGTCTGGTCGTGGG + Intergenic
1016638334 6:146320576-146320598 CTGTGAGTCTGTCTGGTCCTGGG + Intronic
1017848903 6:158285579-158285601 CTGAGATTCTCTCTGTATGTTGG + Intronic
1018090668 6:160345152-160345174 CTCAGAGTGTGGTTGGAAGTGGG - Intergenic
1020073623 7:5243360-5243382 CTGCGAGTCTGTCAAGAAGAGGG - Intergenic
1021129782 7:16897571-16897593 CTGTGAGTCTGTCTGGTCCTGGG + Intergenic
1021706196 7:23370471-23370493 CTGAAAATCTCTCTGGAAATGGG + Intronic
1024977327 7:55125949-55125971 CTGAGAGTGTGAGGGGAAGTGGG - Intronic
1025161640 7:56666429-56666451 CTGGGACACTGTCTGCAAGTGGG + Intergenic
1028343938 7:89757504-89757526 CTTAGAGTCTGGCTGGAAACAGG - Intergenic
1028644474 7:93079918-93079940 CTGTGAGTCTGTCTGGTCCTGGG - Intergenic
1030618145 7:111760182-111760204 CTGAGCTTCTGCCTGGAAGATGG + Exonic
1031771765 7:125852544-125852566 GTGATAGGCTGTCTGCAAGTTGG - Intergenic
1031986923 7:128169252-128169274 CTGTGAGAATGTCTGGAAGGGGG - Intergenic
1032388054 7:131538195-131538217 CTGAGGGTCTGCCTGGGGGTAGG - Intronic
1033597461 7:142867621-142867643 AGGAGAGTCTTTCTGGAAGCTGG - Exonic
1033953544 7:146815085-146815107 CTGAGAGCATGTCTAGAAGATGG + Intronic
1034426778 7:151018201-151018223 CGGAGGGTCTGTCTGGGAGAGGG - Intronic
1039316759 8:36382138-36382160 CTGAGACTTTGTCTGGCAGTGGG + Intergenic
1039685605 8:39798650-39798672 CTGTGAGTCTGTCTGGTCCTGGG + Intronic
1040073592 8:43207171-43207193 ATGGGAGTCTGTCTGGGAATAGG - Intergenic
1040561214 8:48524633-48524655 CTGAGAGGTTGGCTGGCAGTGGG + Intergenic
1041129660 8:54684422-54684444 CTGTAAATCTGTCTGGTAGTAGG + Intergenic
1044257156 8:90078003-90078025 CTTAGACACTGTATGGAAGTGGG + Intronic
1044319101 8:90782271-90782293 ATGAGCGTGTGTCTGGAAGGTGG + Intronic
1044542386 8:93422367-93422389 CTTAGAATATGTCAGGAAGTGGG + Intergenic
1044804499 8:95991383-95991405 CTGAGAGTCTGTCATTCAGTAGG + Intergenic
1045093918 8:98777137-98777159 TTCAGAGTCTGTCAGTAAGTTGG + Intronic
1046267019 8:111844302-111844324 CTGAGTGTCTGCCTTGAAATAGG - Intergenic
1046550625 8:115711606-115711628 CTAAGAGGCAGTCTGGAAGGGGG - Intronic
1047022437 8:120789767-120789789 CTGAGAATCTGTCTGGCCTTGGG - Intronic
1048896166 8:138994248-138994270 CTGAATGTCCTTCTGGAAGTTGG - Intergenic
1049545671 8:143229483-143229505 CTCAGGGTCTGTGTGGAAGAGGG - Intergenic
1050438933 9:5639640-5639662 TTGAGTTTCTGTCTGGGAGTTGG + Intronic
1050764561 9:9116054-9116076 CTGAGAGGGTGACTGGAAGGAGG + Intronic
1051795500 9:20864540-20864562 TTGAGAGTTTGTCTGCAAGCTGG + Intronic
1054815475 9:69470684-69470706 CTGAGGGTGTGTCTGGACTTTGG - Intronic
1055114097 9:72588593-72588615 CTTAAAGTCTGTCTGCAAATTGG + Intronic
1055340592 9:75278035-75278057 CTTAGAGTAGGTCTCGAAGTTGG + Intergenic
1057896057 9:98909495-98909517 CACAGATTCTGTTTGGAAGTAGG + Intergenic
1059140056 9:111844543-111844565 CTGAGAGTTTGATTGAAAGTGGG + Intergenic
1060870208 9:127033920-127033942 CTCAGATTCTGTCCTGAAGTTGG - Intronic
1186148033 X:6645319-6645341 CTAAGACTCTTTCTGGAACTTGG + Intergenic
1188256798 X:27971639-27971661 GTGAGTGTCTGTTTGGAAATGGG + Intergenic
1189678598 X:43490209-43490231 CTGTGAGTCTGTCTGGTCCTGGG - Intergenic
1190434413 X:50409040-50409062 CTGTGATTCTATATGGAAGTAGG + Intronic
1191120650 X:56900381-56900403 CTGTGAATCTGTCTGGATCTGGG - Intergenic
1191743389 X:64460191-64460213 CTGTGAGTCTGTCTGGTCCTGGG + Intergenic
1193298110 X:79855502-79855524 CTTATATTTTGTCTGGAAGTAGG + Intergenic
1193625689 X:83817848-83817870 CTGTGAATCTGTCTGGATCTGGG + Intergenic
1193835338 X:86336359-86336381 CTGTGAGTCTGTCTGGTCCTGGG + Intronic
1195104412 X:101589919-101589941 CTGTGAGTCTGTCTGGTCCTGGG + Intergenic
1196031891 X:111100765-111100787 CAGAGATTCTGTCAGGAAGTTGG + Intronic
1196589104 X:117464803-117464825 CTGTGAATCTGTCTGGTACTGGG + Intergenic
1196606952 X:117668118-117668140 CTGTGAGTCTGTCTGGTCCTGGG + Intergenic