ID: 1156062088

View in Genome Browser
Species Human (GRCh38)
Location 18:33091181-33091203
Sequence TGTCAAATGCGTGAAGTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156062088 Original CRISPR TGTCAAATGCGTGAAGTGAT TGG Intronic
905503837 1:38460645-38460667 TGTGAAATGCCTGGAGCGATGGG - Intergenic
905804157 1:40863811-40863833 TGTCAAATGCGTGGAGGGTAAGG - Intergenic
906127089 1:43433339-43433361 TGTAAGATGTGGGAAGTGATCGG - Intronic
906263361 1:44409232-44409254 TTTCAAATCCTTGACGTGATGGG - Intronic
908150660 1:61298116-61298138 TGTCAAGGGAGGGAAGTGATTGG + Intronic
910262992 1:85309456-85309478 TTTTAAATGGGTGAAGTGTTTGG - Intergenic
910766849 1:90790733-90790755 TGTCAAGGGAGGGAAGTGATTGG - Intergenic
911082233 1:93944576-93944598 TGATAAATGCATGCAGTGATGGG - Intergenic
911795820 1:102074902-102074924 TGTGAAATTCTTGAAGTGATAGG + Intergenic
913122627 1:115755744-115755766 GGTAACATGTGTGAAGTGATGGG - Intronic
914386622 1:147175444-147175466 TGTCAAGGGAGGGAAGTGATTGG + Intronic
919089344 1:192959679-192959701 TGTTAAATGTCTGAAGTGATGGG - Intergenic
919579982 1:199359311-199359333 TGTCATAAGCATGCAGTGATTGG - Intergenic
921831850 1:219736414-219736436 TGTTAAATGAGTGAACTGACTGG - Intronic
1063150252 10:3330356-3330378 TTGCAAATATGTGAAGTGATAGG + Intergenic
1065618009 10:27548724-27548746 TGATAAATGCTTGAGGTGATGGG + Intergenic
1067760888 10:49045917-49045939 TGTCAAGGGAGGGAAGTGATTGG + Intronic
1068375272 10:56170199-56170221 TGTCAAGGGAGGGAAGTGATTGG - Intergenic
1068840126 10:61603310-61603332 TGATAAATGCTTGAGGTGATGGG - Intergenic
1071197434 10:83177507-83177529 TGTCAAACTCATGAAGTCATAGG + Intergenic
1071441197 10:85697747-85697769 TTTCAATAGCCTGAAGTGATTGG - Intronic
1075464348 10:122640407-122640429 AGTCAAAGACGTGAAGTCATTGG - Exonic
1076606671 10:131694098-131694120 AGGCAAATGTGTGAGGTGATAGG + Intergenic
1080165853 11:29235538-29235560 TTTCATTTACGTGAAGTGATAGG + Intergenic
1082649201 11:55767185-55767207 TGTCAAATACGTGTATTGTTAGG + Intergenic
1084152224 11:67293811-67293833 TTTTAAATGGGTGAAGGGATAGG - Intronic
1088586233 11:111362275-111362297 TGACAAATGCTTGAGGGGATGGG - Intronic
1089652515 11:119923662-119923684 TGTCAAAGGCCTGAGGAGATTGG - Intergenic
1090194808 11:124805733-124805755 TGTCACATGCATGTACTGATAGG - Intergenic
1090888860 11:130904918-130904940 TGTGAGATGTGTGAAGGGATGGG + Intronic
1093353395 12:18132066-18132088 TGTCATATGCTTGCACTGATAGG - Intronic
1093416393 12:18925604-18925626 GGATAAATGCATGAAGTGATGGG - Intergenic
1094702513 12:32883834-32883856 TTTCAAAATTGTGAAGTGATGGG + Intronic
1095262521 12:40112990-40113012 TGTCAAAGGAGGGAGGTGATTGG + Intergenic
1097387880 12:58972304-58972326 TGATAAATGCTTGAGGTGATGGG - Intergenic
1098491181 12:71081132-71081154 TTTGAAATACGTGAAGTGATGGG - Intronic
1099099898 12:78425739-78425761 TTTCAAATTCATGAAGTCATTGG + Intergenic
1099644285 12:85331074-85331096 AGTAAAATGCATGAAGTAATGGG - Intergenic
1100480652 12:94975038-94975060 GGACAAATGCTTGAAGGGATGGG + Intronic
1103045120 12:117729703-117729725 TGTCAAATGAATGAATGGATGGG - Intronic
1104762314 12:131304884-131304906 TGTCAAATGTGTTCAGAGATGGG + Intergenic
1104817462 12:131655912-131655934 TGTCAAATGTGTTCAGAGATGGG - Intergenic
1109173460 13:59125195-59125217 TGTCAAAGCAGTGAAGTGATGGG + Intergenic
1109631071 13:65046884-65046906 AGACAAATGCTTGAGGTGATGGG - Intergenic
1110139739 13:72113878-72113900 TGTCAAATGGTTGTAATGATAGG + Intergenic
1110642557 13:77842342-77842364 TGTCAAGGGAGGGAAGTGATTGG + Intergenic
1110802521 13:79715684-79715706 TGTCGAAAGAGGGAAGTGATTGG - Intergenic
1110852876 13:80264456-80264478 TGTCAAAGGAGGGAGGTGATTGG - Intergenic
1113167195 13:107455006-107455028 TGTCAAGGGAGTGAGGTGATTGG + Intronic
1115590715 14:34862360-34862382 TGTAAAATTTGTGAAATGATAGG - Intronic
1115670336 14:35604022-35604044 TGATAAATGTTTGAAGTGATGGG + Intronic
1116575063 14:46563588-46563610 TGTCAAAGGGGAGAAGTGATTGG - Intergenic
1122055799 14:99097500-99097522 TGTCAAATGTGTGAATAAATAGG - Intergenic
1123984519 15:25633374-25633396 TGATAAATGCTTGAGGTGATGGG - Intergenic
1127261253 15:57328060-57328082 ACTCAAATGCCTTAAGTGATGGG - Intergenic
1131657503 15:94476954-94476976 TGTCCAAAGCATGAGGTGATTGG + Intronic
1131712030 15:95066378-95066400 TGATAAATGCTTGAGGTGATGGG + Intergenic
1132123928 15:99203435-99203457 TGATAAATGCTTGAGGTGATGGG - Intronic
1133729468 16:8567398-8567420 TATCAAATGCATGAATGGATGGG + Intergenic
1135181541 16:20278818-20278840 TGACAAATGCGTGAAGTCAAGGG + Intergenic
1137582471 16:49641693-49641715 TTTCAGATGCGTAAAGTGAGTGG - Intronic
1142654719 17:1383887-1383909 TTTTAAATGTGTGAAGAGATGGG - Intronic
1143884972 17:10058470-10058492 TGTCAAATGTTTGATGTTATAGG + Intronic
1144814412 17:18023732-18023754 TGGCAAATCAGTGAACTGATTGG + Intronic
1149097371 17:52859685-52859707 TTTCAAATCTGTAAAGTGATTGG + Intergenic
1149388491 17:56166268-56166290 TGTGAAATGAATGAAGTGATTGG + Intronic
1150735187 17:67730752-67730774 TGACAAATGCTTGAGGTGATGGG - Intronic
1153252643 18:3137832-3137854 TGACAAATGTTTGAGGTGATGGG + Intronic
1155637340 18:27971474-27971496 TGTCACTTGCATGAAGTGACAGG + Intronic
1156062088 18:33091181-33091203 TGTCAAATGCGTGAAGTGATTGG + Intronic
1156759688 18:40573354-40573376 TATCAAATGCTAGAAATGATGGG + Intergenic
1159643068 18:70886708-70886730 TGTCAAAGGAGGGAAGTGATTGG + Intergenic
1159971220 18:74656846-74656868 TGTCAAATACATTAAGTGATGGG - Intronic
1161358935 19:3835179-3835201 TGTAAATTGGGTGCAGTGATAGG - Intronic
926094811 2:10074189-10074211 TGTCAACTGCGAAAAGTGGTTGG - Intronic
930877974 2:56241288-56241310 CGATAAATGCTTGAAGTGATGGG - Intronic
932141900 2:69286411-69286433 TGTGGAAGGAGTGAAGTGATTGG - Intergenic
933009463 2:77040899-77040921 TGACAAATGTTTGAGGTGATAGG - Intronic
933782864 2:85813988-85814010 CGTCAAAGGTGTGAAGTGGTTGG - Intergenic
935836047 2:107054933-107054955 TGATAAATGCTTGAATTGATGGG + Intergenic
935872550 2:107467025-107467047 TGTTAAATAAGTGAAGTGCTGGG + Intergenic
942905577 2:181176366-181176388 TGTGAAATGTCTGAATTGATTGG + Intergenic
943608441 2:190003998-190004020 TGACAATTGTGAGAAGTGATTGG - Intronic
946625558 2:221608896-221608918 TGTCACAAATGTGAAGTGATTGG - Intergenic
1169013512 20:2272056-2272078 TGACAAATGCGTGCAGCCATGGG + Intergenic
1169837295 20:9894631-9894653 TGATAAATACTTGAAGTGATGGG + Intergenic
1170256445 20:14349365-14349387 GGACAAATGCTTGAAGGGATGGG - Intronic
1173922968 20:46759571-46759593 TGTCAATGGAGTGAGGTGATTGG + Intergenic
1174048945 20:47754076-47754098 AGTCAAATGCGTGCAGGGAAAGG + Intronic
1174555932 20:51395392-51395414 TGTCATTTGCGTGAAGTCAGGGG + Intronic
1175562713 20:59944717-59944739 TCTCAAATGCATAATGTGATGGG - Exonic
1177207201 21:18023520-18023542 TGTCAAATGTGTGGAGTTGTTGG + Intronic
1179574709 21:42300821-42300843 CGTCAGATGCTTCAAGTGATTGG + Intergenic
1185327137 22:50232047-50232069 TTTAAAATGCCTGAAGAGATGGG - Intronic
952917727 3:38261873-38261895 TGTCAAAGACGTGAAGTCACAGG + Intergenic
954098720 3:48352986-48353008 TGACAAATGCCTGAAGTGGAAGG - Intergenic
955580328 3:60412788-60412810 TGTCAAAGGAGGGAAGTAATTGG + Intronic
959287741 3:104438646-104438668 TTTTAAATGCTTGAAGTGAAAGG + Intergenic
960791946 3:121442263-121442285 TGATAAATGCTTGAGGTGATGGG - Intronic
961373821 3:126449444-126449466 TGTGAAATGGGGAAAGTGATGGG - Intronic
962307878 3:134304646-134304668 TGTCAAATAGGTGAAGGGAAGGG + Intergenic
965083197 3:164062705-164062727 TGTCAAATATTTGAGGTGATGGG + Intergenic
965717372 3:171620084-171620106 TGATAAATGCTTGAAGTGATAGG + Intronic
968212401 3:196859973-196859995 TGTCAAGGGAGGGAAGTGATTGG - Intergenic
969531253 4:7732424-7732446 TGACAAATGCGTGAGGTGCCCGG - Intronic
970293920 4:14607228-14607250 TGTCGAAAGAGGGAAGTGATTGG + Intergenic
977677530 4:99764368-99764390 TGTCAAGGGAGGGAAGTGATTGG + Intergenic
978295760 4:107203451-107203473 TGTAAAATACCTGAAGTGCTCGG - Intronic
978918979 4:114159011-114159033 GGATAAATGCTTGAAGTGATTGG + Intergenic
979763755 4:124439408-124439430 TGATAAATGCTTGAGGTGATGGG - Intergenic
980327489 4:131366927-131366949 TTTCAAATGCATGGAGTGAGAGG + Intergenic
980596399 4:134961269-134961291 TGTCAAGGGAGGGAAGTGATTGG + Intergenic
982459923 4:155656331-155656353 TTTGAAATGCGTAAAGTGATAGG + Intergenic
982705283 4:158702281-158702303 TGACAAAGGTTTGAAGTGATGGG - Intronic
985287172 4:188348002-188348024 TGATAAATGCTTGAGGTGATGGG + Intergenic
986510183 5:8496728-8496750 TGTCAAGTGAGGGAGGTGATTGG - Intergenic
986828602 5:11549983-11550005 TGTTATATGCGTGAATAGATAGG - Intronic
987186321 5:15423835-15423857 TGTCAAGGGAGGGAAGTGATTGG + Intergenic
989263282 5:39443412-39443434 TGCCAAATGTTTGTAGTGATTGG + Intronic
990999943 5:61772503-61772525 TGTCAAAGGAGGGAAGTGATTGG + Intergenic
991185001 5:63796054-63796076 TGTCAAGGGAGTGAGGTGATTGG - Intergenic
992914091 5:81430858-81430880 TTTGAAAAGCCTGAAGTGATAGG + Intronic
993233977 5:85279143-85279165 GGTCAAATGGTTGAAGTTATGGG - Intergenic
993269803 5:85780970-85780992 TGATAAATGCTTGACGTGATGGG - Intergenic
994319884 5:98381830-98381852 TGATAAATGCTTGAGGTGATGGG - Intergenic
997090994 5:130857724-130857746 TGTGAAATGTGGGATGTGATAGG + Intergenic
997227008 5:132216457-132216479 TGTCAAATGGGTCAAGTCATTGG - Intronic
1005909276 6:30294014-30294036 TGTGAAATGGGAGATGTGATAGG + Intergenic
1006790186 6:36695283-36695305 TGTCAAAGGAAGGAAGTGATTGG - Intergenic
1008096579 6:47345339-47345361 TGCCACATGCTTGAAGTGAAAGG + Intergenic
1012811808 6:103968132-103968154 TGTCAAAGGAGGGAGGTGATTGG - Intergenic
1013419498 6:109953091-109953113 TGTCCAATGCCTGAAATGGTTGG + Intergenic
1014342466 6:120227467-120227489 TGTCAAGGGAGGGAAGTGATTGG - Intergenic
1017262285 6:152401511-152401533 TGCCAAACACATGAAGTGATGGG + Intronic
1018520601 6:164646118-164646140 TGTCTAATGCATGCAGTAATAGG - Intergenic
1018878259 6:167846050-167846072 TGTCAAGGGAGGGAAGTGATTGG - Intronic
1019075441 6:169383554-169383576 TGTCAAGGGAGGGAAGTGATTGG + Intergenic
1019953765 7:4395318-4395340 TGTCAAGGGAGGGAAGTGATTGG + Intergenic
1020447819 7:8287226-8287248 TGTCAAATGCATTTAGTCATTGG + Intergenic
1024689356 7:51782387-51782409 TGATAAATGCTTGAAGTGATGGG + Intergenic
1024765559 7:52654217-52654239 TGACAAATGCGTGAAGTTTTAGG - Intergenic
1025826252 7:65013298-65013320 GGACAAATGCTTGAGGTGATGGG + Intergenic
1025913813 7:65849759-65849781 GGACAAATGCTTGAGGTGATGGG + Intergenic
1029644309 7:101843686-101843708 TGTCAAACAAGTTAAGTGATAGG + Intronic
1030569726 7:111207974-111207996 AGACAAATGTGTGAAATGATGGG - Intronic
1031384724 7:121134611-121134633 TGTTAAATGTTTGAAGTGATAGG + Intronic
1035913055 8:3589768-3589790 TGACAAATATGTGAAGTAATGGG + Intronic
1043843261 8:85134163-85134185 TGTGAAGTGTGTGAAGTGTTGGG - Intronic
1047820413 8:128513541-128513563 TTTCAAATCCAGGAAGTGATGGG + Intergenic
1048233301 8:132664802-132664824 TGACAGTTGCATGAAGTGATTGG - Intronic
1048429687 8:134358563-134358585 AGTCAGATGCTTGAAGGGATGGG - Intergenic
1048978359 8:139688526-139688548 TGTCAAGGGAGGGAAGTGATCGG - Intronic
1051827885 9:21241200-21241222 TGTCAAATGGGTGCTGTGATTGG - Intergenic
1054746264 9:68856904-68856926 TGCCAAGTGTGTGAAGTTATTGG - Intronic
1057745000 9:97744149-97744171 TGTCAAAGGCGGGATCTGATGGG + Intergenic
1061877635 9:133552785-133552807 AGTTAAATGCGGGATGTGATGGG + Intronic
1186037502 X:5440872-5440894 TGTCAAGGGAGGGAAGTGATTGG - Intergenic
1186943019 X:14532540-14532562 TTTCAAATGTGGGAAGTGACAGG - Intronic
1187777184 X:22774125-22774147 ACTCAAATGTGTGTAGTGATAGG + Intergenic
1190565667 X:51728137-51728159 GGACAAATGCTTGATGTGATGGG - Intergenic
1191963954 X:66735630-66735652 TGATAAATGCTTGAGGTGATGGG - Intergenic
1193486120 X:82086979-82087001 TGTCAAATAGGTGAAGTGTGGGG + Intergenic
1193756176 X:85411235-85411257 AGATAAATGCCTGAAGTGATGGG - Intergenic
1193796211 X:85877617-85877639 TGATAAATGCTTAAAGTGATGGG + Intronic
1193996217 X:88368039-88368061 TGTCAAGGGAGGGAAGTGATTGG - Intergenic
1194187185 X:90786708-90786730 TGTCAAGGGAGGGAAGTGATTGG - Intergenic
1199921571 X:152410394-152410416 TGAAAAATGCTTGAGGTGATGGG + Intronic
1200533779 Y:4368759-4368781 TGTCAAGGGAGGGAAGTGATTGG - Intergenic
1200957563 Y:8967464-8967486 TGTCATATGCCTGCAGTCATTGG - Intergenic