ID: 1156067020

View in Genome Browser
Species Human (GRCh38)
Location 18:33155831-33155853
Sequence AACATAAAGTCCTACATTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156067016_1156067020 21 Left 1156067016 18:33155787-33155809 CCAGGAACACATACTAGCAGACC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1156067020 18:33155831-33155853 AACATAAAGTCCTACATTACTGG 0: 1
1: 0
2: 1
3: 12
4: 169
1156067019_1156067020 -1 Left 1156067019 18:33155809-33155831 CCAGACATGGAAATGATACAGAA 0: 1
1: 0
2: 1
3: 25
4: 262
Right 1156067020 18:33155831-33155853 AACATAAAGTCCTACATTACTGG 0: 1
1: 0
2: 1
3: 12
4: 169
1156067018_1156067020 0 Left 1156067018 18:33155808-33155830 CCCAGACATGGAAATGATACAGA 0: 1
1: 0
2: 4
3: 58
4: 570
Right 1156067020 18:33155831-33155853 AACATAAAGTCCTACATTACTGG 0: 1
1: 0
2: 1
3: 12
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156067020 Original CRISPR AACATAAAGTCCTACATTAC TGG Intronic
906179999 1:43810032-43810054 AACATAGAGTGAAACATTACTGG + Intronic
906829975 1:49020806-49020828 AACAGAAAATCCTAAAATACAGG + Intronic
908108789 1:60874438-60874460 CACATAAATTACTACACTACAGG + Intronic
911947713 1:104134089-104134111 AACGTAAAATCATACATTAAGGG - Intergenic
912309093 1:108601576-108601598 AACATAAAGTCTTAAATTAGGGG + Intronic
912731204 1:112107338-112107360 AACACAAAGACCTACAATAGAGG - Intergenic
915615219 1:157032596-157032618 AAATTAAAGTCCTACCTGACAGG + Intronic
916376525 1:164159836-164159858 AACTTAAAGTTGTACATTACAGG - Intergenic
923409106 1:233689939-233689961 CACTGAAAGTCCTACATTTCAGG - Intergenic
1063075102 10:2708586-2708608 AATATATAGTTCTACATTAAAGG - Intergenic
1064412891 10:15123183-15123205 AACAGAAAGTCCTAGAAAACAGG + Intronic
1065783072 10:29188901-29188923 AACATTAAGTGATACATGACTGG + Intergenic
1073960299 10:108919146-108919168 AACCTAAAGTTCTAGATTATGGG + Intergenic
1074498577 10:114001899-114001921 AACAGAAAGTCTCACATTCCAGG - Intergenic
1075431197 10:122382989-122383011 AACAGAAACTCTTACATTGCTGG - Intronic
1077717182 11:4593689-4593711 ACCATAAACTCATACAGTACTGG + Intergenic
1077924496 11:6667488-6667510 AACATAAAATCTCACATTAAAGG - Intergenic
1078569710 11:12447104-12447126 AGTATAAACTGCTACATTACAGG - Intronic
1079612232 11:22447503-22447525 AACTTAAAGTTCCACATGACTGG + Intergenic
1079761682 11:24337273-24337295 AATATACAGACCTACATTATTGG - Intergenic
1080728504 11:34921588-34921610 AAAATAAAATACTGCATTACTGG - Intronic
1081252579 11:40853212-40853234 AAAATAAATGACTACATTACTGG + Intronic
1081560661 11:44212520-44212542 AACTTGAACTCATACATTACTGG + Intronic
1081750882 11:45510468-45510490 AACATAAAGTCCTTCATTTAAGG + Intergenic
1082853502 11:57786064-57786086 GCCATTAAGTCCTACATTACTGG - Intronic
1085614517 11:77985972-77985994 AACATAAAATACCACATTTCTGG + Intronic
1089418719 11:118315255-118315277 AACTTAAAGACCCACATTCCAGG - Intronic
1090165929 11:124546892-124546914 ATCATAAAGTCAAAAATTACTGG + Intergenic
1090571546 11:128052813-128052835 AACATCAAGTCCTATATTTTGGG - Intergenic
1093502937 12:19832978-19833000 ATCACCAAGTCCTACACTACTGG - Intergenic
1094689323 12:32753333-32753355 AAAATAAAGACCTACATAAATGG - Intronic
1098684729 12:73404247-73404269 AACATAAATTCTTGCATTAGTGG + Intergenic
1102420430 12:112799067-112799089 AACACAAAGTCCTATATCCCAGG - Intronic
1103658025 12:122489710-122489732 AATATATAGTTTTACATTACTGG + Intronic
1106744874 13:32690948-32690970 AATATAAAGTACTAAAATACTGG - Intronic
1106798361 13:33231076-33231098 AACTTAAAGTCCTGCATCTCAGG + Intronic
1106968045 13:35097017-35097039 GAAATAAAGTACTTCATTACAGG - Intronic
1107488581 13:40857499-40857521 CACATAATGTCCAACATTAGAGG + Intergenic
1107810208 13:44193424-44193446 AAGATAAAGTCCTACAAGAATGG - Intergenic
1108562672 13:51661844-51661866 AAGATACTGTCGTACATTACAGG + Intronic
1109162246 13:58990610-58990632 AACATTAACTCCTACAATATGGG + Intergenic
1109694340 13:65933784-65933806 AATATAAAAACATACATTACTGG + Intergenic
1110473425 13:75886341-75886363 AACAAAAAATCCTACATGACTGG - Intergenic
1111044431 13:82796274-82796296 AACAGAAAGGCCTGCATCACTGG + Intergenic
1112900378 13:104351055-104351077 AACATAGAGTGGTAGATTACAGG - Intergenic
1112907738 13:104445288-104445310 AACATAAAGCTCAACATCACTGG + Intergenic
1114131256 14:19796002-19796024 AACATGAAGACCTCAATTACTGG + Intronic
1115824693 14:37255577-37255599 ATAATAACGTCCTACATGACAGG - Intronic
1116712590 14:48387439-48387461 AAAATAAAGTAAAACATTACAGG - Intergenic
1117112657 14:52475052-52475074 AACCTAAAGGTCTAGATTACGGG + Intronic
1118432901 14:65739602-65739624 AACACAAGGTCCTGCATTCCTGG + Intronic
1120876472 14:89380404-89380426 AACACAAAGTCCTATTTCACAGG + Intronic
1123574316 15:21651589-21651611 AACATGAAGTCCTCAATAACTGG + Intergenic
1123610931 15:22094176-22094198 AACATGAAGTCCTCAATAACTGG + Intergenic
1124087630 15:26566070-26566092 TACATAAAGACTGACATTACTGG + Intronic
1125825574 15:42673422-42673444 AACAAAAAGACATTCATTACTGG + Intronic
1126128505 15:45317689-45317711 AAAATAAAGTAATACATTAATGG + Intergenic
1126683233 15:51224442-51224464 TACAAAAAGTGCTACATAACTGG - Intronic
1126744866 15:51815841-51815863 CACATAAAGTCACACATTACAGG - Exonic
1128348266 15:66869156-66869178 AAATTAAAGTCCTAGATTTCTGG + Intergenic
1129914113 15:79253484-79253506 AACATAAGGTCCAACATGGCAGG - Intergenic
1131211992 15:90505531-90505553 AAGATAAAATATTACATTACTGG - Intergenic
1133827525 16:9291613-9291635 AACAAAAAGCCCTACATCTCGGG + Intergenic
1135675938 16:24414936-24414958 AACATCAAGTCCTGAATTCCTGG - Intergenic
1137703693 16:50518766-50518788 ATAATAAATTCCTACCTTACCGG - Intergenic
1140909272 16:79437336-79437358 AACATGAAGACGTACATTACAGG + Intergenic
1153974722 18:10258464-10258486 AACATAAAAACCTACATGATGGG + Intergenic
1154393181 18:13961044-13961066 AAAATAAAGTCCTTTATTAAAGG - Intergenic
1155055866 18:22183058-22183080 AGCATAGACTCCTAAATTACTGG + Intronic
1156067020 18:33155831-33155853 AACATAAAGTCCTACATTACTGG + Intronic
1156324881 18:36065766-36065788 AACATAAAGTGGTACCTCACTGG + Intronic
1156971137 18:43158039-43158061 AACATAAAGTTCTAAATTCATGG + Intergenic
1156973374 18:43185350-43185372 AATATAAATGCCTACATCACAGG - Intergenic
1159288117 18:66379003-66379025 AACATTAACTCCTACATTAGAGG - Intergenic
1159408157 18:68033533-68033555 TAAATAAAGTCCTACATAATGGG + Intergenic
1160262434 18:77307353-77307375 AAAATAAATTCATACATTATAGG - Intergenic
1160480150 18:79232504-79232526 AACATAAAGCCCCACACTAAAGG + Intronic
1164760751 19:30726668-30726690 AACATAAAGGCCCAGATAACCGG + Intergenic
1164774187 19:30838931-30838953 AACAGAAAATCCTATATTCCAGG + Intergenic
1164798481 19:31056055-31056077 AACATAAATCCCCACATTAAAGG - Intergenic
1167870364 19:52364359-52364381 AATATAAAGTTCTCCATTAAAGG - Intronic
1168445542 19:56409149-56409171 AACATAAGGTCATACATGTCAGG - Intronic
1168480281 19:56714504-56714526 AATATCTAGTCCTACATTTCTGG + Intergenic
1168485276 19:56756441-56756463 AACATTACTTCCTACATTTCAGG - Intergenic
925080840 2:1064476-1064498 AAAATAAAGTACTACATTTGGGG + Intronic
925692079 2:6535682-6535704 AACAAACAGTCCTACATCTCTGG + Intergenic
927222168 2:20722875-20722897 AACATAAACTCATATATTGCTGG + Intronic
929953946 2:46440985-46441007 AACATACAGTCATACATCACGGG - Intronic
930915095 2:56677114-56677136 AAAATCAAGACCTACATTGCTGG - Intergenic
931738874 2:65224089-65224111 AACAAACACTCCTACATTCCTGG - Intergenic
932030186 2:68175677-68175699 AAATTAAAGACCTACATCACAGG + Exonic
933180844 2:79225516-79225538 AACATAAACTCCTAAAAGACAGG - Intronic
937670024 2:124528699-124528721 TACACAAAGTCCTTCATGACTGG - Intronic
938835722 2:135102233-135102255 ATCTTAAAAACCTACATTACTGG - Intronic
940770672 2:157836496-157836518 CACACAAAGTCCTCCATTTCAGG + Intronic
941232331 2:162926256-162926278 AACAAAATGTCCTAAATTCCAGG + Intergenic
941275645 2:163487380-163487402 AACATACTGGCCTGCATTACTGG + Intergenic
941632669 2:167902239-167902261 AAAATAAAGTCTTACATTTATGG + Intergenic
941910708 2:170762043-170762065 AGAATAAAGTCATAGATTACAGG + Intergenic
943355909 2:186855175-186855197 AACATAAAATTATACATTCCTGG - Intergenic
945305870 2:208258131-208258153 AAAATCAACTCCTCCATTACTGG - Intronic
948666742 2:239539442-239539464 TACATAAAGTCCTACTTACCAGG - Intergenic
1170618311 20:17972695-17972717 AACATGAAAACCTAGATTACAGG - Intronic
1172806138 20:37613195-37613217 AACTTAAAGTCTTACATCCCAGG + Intergenic
1174973005 20:55298709-55298731 GAAATAAAGTCCTACATTTATGG + Intergenic
1175306131 20:57976921-57976943 AACATAAAGTCCTTGAAGACTGG - Intergenic
949465294 3:4337397-4337419 AACACAAATTACTTCATTACTGG + Intronic
951830575 3:26921949-26921971 AACTCAAAGTCCTTCATTTCCGG + Intergenic
958994241 3:100883656-100883678 AACATAAACTGATACATTGCTGG + Intronic
962153344 3:132916912-132916934 AACATAAAACCTTACACTACAGG - Intergenic
963339886 3:144021075-144021097 AACTTACAGTTCTACATGACTGG + Intronic
963400655 3:144793014-144793036 AAAATAAATTCCTATATTTCTGG - Intergenic
966582480 3:181583641-181583663 AATACAAAGTTCTTCATTACAGG + Intergenic
970088124 4:12370647-12370669 ATGATAAAGTCTAACATTACAGG - Intergenic
970595669 4:17597801-17597823 AACATACTGTCCTACATCATGGG + Intronic
974766110 4:66348699-66348721 CACATAATGTCCTACATCCCAGG + Intergenic
976357769 4:84139114-84139136 AACATAAACCTCTACATTAAGGG + Intergenic
976548577 4:86366928-86366950 CACTTAAAGTCCTACATCATAGG + Intronic
977115768 4:93025403-93025425 ATTATAGGGTCCTACATTACTGG - Intronic
977161156 4:93637613-93637635 AACAAAGGGTCCTCCATTACAGG + Intronic
977298971 4:95245651-95245673 AAAATAAAATCTTACAGTACTGG + Intronic
978560419 4:110028059-110028081 AACATAAAGTCCATAATTGCAGG + Intergenic
980057504 4:128093024-128093046 ATCATCAAGTCCTACCTTAGAGG - Intronic
983593504 4:169441083-169441105 CACATACAGTCCTACACCACAGG + Intronic
984531031 4:180916496-180916518 CACATTAAGTCCTAAATTAATGG + Intergenic
988471050 5:31538987-31539009 AAAATTAAGTCATACAGTACAGG + Intronic
992405794 5:76456481-76456503 AACCTAAAGTCCAAGATTTCAGG - Intronic
995113398 5:108453017-108453039 AACTTACAGTTCTACATCACTGG - Intergenic
1001338531 5:170822347-170822369 AACATAAAGTTTTGCATTAAAGG + Intergenic
1004567342 6:16810556-16810578 AACATAAAGCCTCACATTAGAGG - Intergenic
1005497127 6:26397577-26397599 CTCCTAAAGTGCTACATTACAGG + Intergenic
1005948420 6:30612785-30612807 AATGTAAAGTCCAACATTTCGGG + Intronic
1006969397 6:38025760-38025782 AACATACAGTCTTTCATGACTGG - Intronic
1008524402 6:52393805-52393827 CACTTAAAGTCCTTCATTATAGG - Intronic
1009038041 6:58141804-58141826 TTCATAAAGTCATACAGTACAGG - Intergenic
1009653455 6:66507259-66507281 AAGATAAGGTCCTAGATTTCAGG - Intergenic
1013415652 6:109922182-109922204 AACACAAAGTTCTACATTTAGGG + Intergenic
1016128521 6:140436195-140436217 AACATAAATCCTCACATTACAGG - Intergenic
1016574753 6:145556556-145556578 AACATAAAGTAATACTGTACAGG + Intronic
1020346607 7:7172037-7172059 AAAATAAAGGCCTACAGTAAAGG - Intronic
1021309222 7:19072022-19072044 AACATAAAACTCTACATTAAAGG + Intronic
1027448371 7:78300994-78301016 AACATTAATTCCTACATTACAGG - Intronic
1027866490 7:83654334-83654356 CAAATAAAGTCCTATATTCCAGG + Intergenic
1028823186 7:95236944-95236966 AAAATAAAGTTCTACATGTCTGG - Intronic
1030793993 7:113764656-113764678 AACATAAACTCCTAAGTTGCAGG - Intergenic
1033965025 7:146964910-146964932 AACACAATGTTCTACATTAGGGG - Intronic
1037209501 8:16369023-16369045 AACATAAAGTCCGACCTGACAGG - Intronic
1037222022 8:16535615-16535637 AAAAAAAAGTCATACATTACTGG - Intronic
1037320954 8:17642051-17642073 AAGATAATGTACTACATGACAGG - Intronic
1038349712 8:26764720-26764742 AACATAAAGTGCTATATAAACGG + Intronic
1039202336 8:35109762-35109784 AACAAAATGTCCTACATTCTAGG + Intergenic
1042385604 8:68170223-68170245 TACATACAGCCCTACATGACTGG - Intronic
1042725302 8:71868666-71868688 AACATGAACCCCTACACTACAGG + Intronic
1046360477 8:113147494-113147516 TACATAAAGACCTACAATAATGG - Intronic
1047149039 8:122240376-122240398 AACTTACAGTCCCACATGACTGG - Intergenic
1048643016 8:136385667-136385689 AAGATCAAGTTCTATATTACAGG + Intergenic
1049853388 8:144846646-144846668 AACCTAAAGTCCAACAATCCAGG + Intronic
1050092669 9:2030823-2030845 GACCTAAAGTCCTACGTAACTGG - Intronic
1050939087 9:11437186-11437208 AACATTAAGTCCTGCAATAGTGG - Intergenic
1052721299 9:32174039-32174061 AAAATAAAATACCACATTACTGG - Intergenic
1053011441 9:34635975-34635997 AACAAAAAGCCCTACCTCACTGG + Intronic
1053306181 9:36986226-36986248 CAAATAAAGTCATTCATTACGGG + Intronic
1053389748 9:37726025-37726047 ACAATAAAGGCCCACATTACAGG + Intronic
1053554628 9:39122628-39122650 AACATAAAACCTTACATTAAAGG + Intronic
1053818750 9:41942884-41942906 AACATAAAACCTTACATTAAAGG + Intronic
1054109012 9:61086542-61086564 AACATAAAACCTTACATTAAAGG + Intergenic
1054611845 9:67244583-67244605 AACATAAAACCTTACATTAAAGG - Intergenic
1056681403 9:88722135-88722157 ACAACAAAGTCCTACATCACAGG + Intergenic
1059767137 9:117394250-117394272 AACATAAATTTCTGCAATACTGG + Intronic
1061648052 9:132022399-132022421 AAACTAATGTCCTACATTTCTGG - Intronic
1186316722 X:8378487-8378509 AACAGAAATTCCTACACCACTGG - Intergenic
1187309337 X:18126185-18126207 AACATAAAACCTTACATTAAAGG + Intergenic
1187465664 X:19525536-19525558 AACATAAAGTCCCACACTAAAGG - Intergenic
1190760880 X:53437189-53437211 CACATATATTACTACATTACAGG - Intergenic
1192862301 X:75088214-75088236 AACATAAAATCTCACATTAAAGG + Intronic
1193822884 X:86188020-86188042 AAAATAACCTCCTTCATTACTGG - Intronic
1194321276 X:92448545-92448567 AACATACAGTTCTACATGGCAGG - Intronic
1195481250 X:105348017-105348039 AAGATAAAGACCAAGATTACTGG - Intronic
1197533271 X:127657382-127657404 CCCATAAACTTCTACATTACAGG + Intergenic
1197554949 X:127941742-127941764 AACTGGAAGTCCTTCATTACAGG + Intergenic
1199883948 X:152000117-152000139 AAAAAAAAGTCCTTCAATACAGG - Intergenic
1200629393 Y:5561692-5561714 AACATACAGTTCTACATGGCAGG - Intronic
1201711981 Y:17002443-17002465 CACATAAAGTTCTCCATTAAAGG - Intergenic