ID: 1156069554

View in Genome Browser
Species Human (GRCh38)
Location 18:33189889-33189911
Sequence GTGGTAGCCCTAATCTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 64}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156069554 Original CRISPR GTGGTAGCCCTAATCTTGGG TGG Intronic
908815453 1:68028204-68028226 GTCTTAGCCCTGATCTTAGGTGG - Intergenic
912798246 1:112705754-112705776 GGGGTAGCCCCAACCTGGGGTGG + Exonic
915439497 1:155936048-155936070 GTGGTAGCCCATGTCTTGCGGGG - Intergenic
915592012 1:156876035-156876057 ACGGTAGCCCCAGTCTTGGGAGG - Intronic
922123822 1:222702151-222702173 GTGGCAACCCTAATCTTTAGGGG + Intronic
1071460515 10:85889346-85889368 GTGGTTACCAGAATCTTGGGAGG - Intronic
1072305170 10:94100322-94100344 GTGGTACCCCTGATTTAGGGAGG - Intronic
1078720012 11:13875668-13875690 TTGAGAGCCCGAATCTTGGGAGG + Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1083741726 11:64714749-64714771 GTGGCTCCCCCAATCTTGGGTGG - Intronic
1089351054 11:117822033-117822055 ATGCTAGCCCTAATCTTGTGAGG + Intronic
1102613073 12:114129548-114129570 GTGGTAGTGCTCATCTTGGTAGG + Intergenic
1103636384 12:122310055-122310077 GTGGCAGCCCTCCTTTTGGGAGG - Intronic
1104495381 12:129232125-129232147 GTTGCAGCCCGGATCTTGGGAGG + Intronic
1104851914 12:131880221-131880243 GTGGATGCCACAATCTTGGGAGG - Intergenic
1108930124 13:55807420-55807442 GTGGAAGCCCTAAGCCTTGGTGG - Intergenic
1121224252 14:92309626-92309648 GTGGAAGCCCTAGGCTTTGGGGG - Intergenic
1122986332 14:105213287-105213309 GTGGGAGGCCTGATCTTGGCCGG + Intronic
1127146905 15:56034172-56034194 GTGGCAGCCCTAATCTAAGTAGG - Intergenic
1135910168 16:26553328-26553350 GAGTTGGTCCTAATCTTGGGAGG - Intergenic
1137618122 16:49858620-49858642 ATGGTAGCGCTAACCTGGGGAGG - Intergenic
1142828865 17:2532524-2532546 GTGGGAGCCCTACTCTGGGCTGG - Intergenic
1156069554 18:33189889-33189911 GTGGTAGCCCTAATCTTGGGTGG + Intronic
1159824934 18:73196088-73196110 GTGGTAGCGGTAATTTTGGAAGG + Intronic
1164387438 19:27786343-27786365 GTGGTATCCCCAAGTTTGGGGGG + Intergenic
926467219 2:13205961-13205983 GTGCTAGCCCTAAGCCTTGGTGG + Intergenic
930715520 2:54590605-54590627 TTGGTAGAACTAATCTTGGCTGG + Intronic
931175025 2:59845731-59845753 CTAGTAGGCCTAATCCTGGGAGG + Intergenic
939449178 2:142350442-142350464 GTAGTAGCTTTAATCTTTGGGGG + Intergenic
942234554 2:173891335-173891357 GGGGTGGCAGTAATCTTGGGAGG - Intergenic
1176038038 20:63049867-63049889 GTGGTAGGCCTGACCTTGGAAGG + Intergenic
1181237289 22:21455480-21455502 GTGTAAGCCCTAGGCTTGGGTGG + Intergenic
951314433 3:21171299-21171321 GTGGGACCCCAAATCTTTGGTGG - Intergenic
953472446 3:43178775-43178797 ATGGTAACCCTCATCTTGAGAGG + Intergenic
956801694 3:72765358-72765380 GAGGTAGAGCTACTCTTGGGAGG - Intronic
956941697 3:74169384-74169406 GTGGAAGCACGAATTTTGGGTGG + Intergenic
958836862 3:99156638-99156660 GTGCAAGCCCTAAACTTTGGTGG + Intergenic
960619071 3:119621879-119621901 GAGCTAGGCCTAATGTTGGGTGG - Intronic
962707799 3:138062158-138062180 GTGGCAGGCCTACTCATGGGTGG - Exonic
962723608 3:138199756-138199778 GTGGTAGTCCTAATCTCTGTAGG + Intronic
965540151 3:169863799-169863821 CTGGCAACCCTAATTTTGGGTGG + Intronic
965647294 3:170897545-170897567 GTGTAAGCCCTAATCCTTGGTGG + Intronic
971254763 4:25004193-25004215 GTGGTAGCCCAGCTCTTCGGTGG - Exonic
984286147 4:177731046-177731068 GTGGTAGCCCTGGACATGGGTGG - Intronic
987642810 5:20633756-20633778 GTGGCAGCCCTACTGCTGGGAGG - Intergenic
989180559 5:38572540-38572562 GTGGTAGCACAAATGTTGAGGGG - Intronic
991746464 5:69747347-69747369 GTGGAAGCACGAATCTTGCGAGG - Intergenic
991751241 5:69807894-69807916 GTGGAAGCACGAATCTTGCGAGG + Intergenic
991798065 5:70327292-70327314 GTGGAAGCACGAATCTTGCGAGG - Intergenic
991825842 5:70622661-70622683 GTGGAAGCACGAATCTTGCGAGG - Intergenic
991830529 5:70682788-70682810 GTGGAAGCACGAATCTTGCGAGG + Intergenic
994620278 5:102154874-102154896 GTGGTAGCCCTTCTCTGGGCTGG + Intergenic
997756695 5:136406332-136406354 GTGGCATCCCTCCTCTTGGGAGG + Intergenic
998736209 5:145144276-145144298 GTGCTGGCCCTAATCCTTGGGGG + Intergenic
1001730073 5:173946960-173946982 ATGTGAGCCCTTATCTTGGGGGG - Intronic
1006197086 6:32251089-32251111 GGGATAGCCCTAATTTTGGCAGG + Intergenic
1016276001 6:142353185-142353207 GTGGGAGCCCATAGCTTGGGTGG - Intronic
1016276006 6:142353204-142353226 GTGGGAGCCTTTAGCTTGGGTGG - Intronic
1024794288 7:53003875-53003897 GTGGGAGCCCTTCTCTTGGCTGG + Intergenic
1033839980 7:145361061-145361083 GTGGTAGCCCTTCTCTGGGCTGG - Intergenic
1034398494 7:150846068-150846090 GTGGTTGCAATAGTCTTGGGGGG - Intronic
1056608526 9:88108260-88108282 CTGGTTGCCCTCATCTGGGGAGG + Intergenic
1057428958 9:94977204-94977226 GTGGAAGGCCTATTCTTGGTGGG + Intronic
1062478949 9:136742686-136742708 CTGGTAGCCCTGCTCCTGGGCGG + Intronic
1186675341 X:11811020-11811042 GTGGTACACATAATCATGGGAGG + Intergenic
1194881182 X:99253764-99253786 GTGTAAGCCATAATCTTTGGTGG - Intergenic
1195370542 X:104167800-104167822 GTGTTAGATCAAATCTTGGGGGG + Intronic