ID: 1156070043

View in Genome Browser
Species Human (GRCh38)
Location 18:33196185-33196207
Sequence CGATTATCCTGACCTCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156070041_1156070043 -7 Left 1156070041 18:33196169-33196191 CCTCTGGAAAAACTAACGATTAT 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1156070043 18:33196185-33196207 CGATTATCCTGACCTCCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 56
1156070040_1156070043 -3 Left 1156070040 18:33196165-33196187 CCAACCTCTGGAAAAACTAACGA 0: 1
1: 0
2: 0
3: 6
4: 164
Right 1156070043 18:33196185-33196207 CGATTATCCTGACCTCCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156070043 Original CRISPR CGATTATCCTGACCTCCAGG AGG Intronic
901499165 1:9640986-9641008 CCAGTGTCCTGACCTCAAGGAGG + Intergenic
901878710 1:12181533-12181555 CCACTACCCTGACCTCCTGGCGG + Intronic
902183300 1:14706022-14706044 TGATGATCCTGAGCTCCAGGAGG - Intronic
904699726 1:32351335-32351357 CGATTTCCCTTCCCTCCAGGTGG - Intergenic
907417728 1:54326116-54326138 AGATTACCCTGAGCTCCAGGAGG - Intronic
913685025 1:121223417-121223439 AGATTAGGCTGACTTCCAGGTGG - Intronic
914036870 1:144011021-144011043 AGATTAGGCTGACTTCCAGGTGG - Intergenic
914152584 1:145056910-145056932 AGATTAGGCTGACTTCCAGGTGG + Intronic
920472343 1:206241974-206241996 AGATTAGGCTGACTTCCAGGTGG - Intronic
1068989070 10:63132856-63132878 CGAGTGTGCTGACCTCTAGGGGG + Intergenic
1074720232 10:116257510-116257532 CTATTAGCCTCAGCTCCAGGTGG - Intronic
1077539903 11:3141603-3141625 GGATTTTGCTGACCTCCAAGGGG + Intronic
1078436186 11:11327741-11327763 CTCTTATCCTCACCTACAGGTGG + Intronic
1079469934 11:20768603-20768625 AGATTATCCTGGATTCCAGGTGG + Intronic
1105059533 12:133136094-133136116 CACCTATCCTGACTTCCAGGAGG + Intronic
1106694144 13:32152690-32152712 AGATTTTCATGACCTTCAGGTGG + Intronic
1127544297 15:59976052-59976074 TGATTCTCCTGAGCTCCTGGTGG - Intergenic
1134903368 16:17958760-17958782 CTATTGTTCTGACCTCCAGCAGG + Intergenic
1135945323 16:26859942-26859964 CAAATATCATGACCTCAAGGTGG + Intergenic
1136996676 16:35195511-35195533 CCATTATCCCCACCTCCAGCTGG - Intergenic
1142489741 17:270441-270463 CGATGATCCTGACCTTCCGTAGG + Intronic
1147846768 17:43409940-43409962 GGATTATCCAGACCCCCAGCTGG - Intergenic
1153510849 18:5850457-5850479 CGATTATCCAGAAGTCCAGGTGG - Intergenic
1155896694 18:31338048-31338070 GGATTATTCTGACATCCAAGTGG + Intronic
1156070043 18:33196185-33196207 CGATTATCCTGACCTCCAGGAGG + Intronic
1168666139 19:58206718-58206740 AGAGTATCCTGAGCTCCAGCTGG + Exonic
929927726 2:46229468-46229490 TGATTATCCTCACCACTAGGTGG + Intergenic
930419879 2:51137020-51137042 CAATTATTCTTACCTACAGGTGG + Intergenic
945594356 2:211773516-211773538 TACTTAACCTGACCTCCAGGTGG - Intronic
948818585 2:240526649-240526671 CAAGCATCTTGACCTCCAGGTGG - Intronic
948826790 2:240576945-240576967 CTACTATCCTGACCTCCACAGGG + Exonic
1171272297 20:23826570-23826592 CGATTATCCTGTCCTCCTCCTGG + Exonic
1172294396 20:33798390-33798412 CCATTATCCTGCCCACCAGGAGG + Intergenic
1173569506 20:44067366-44067388 CCAGTTCCCTGACCTCCAGGTGG - Intronic
1177927332 21:27234933-27234955 CTATAATCCTGCCCTCCATGTGG + Intergenic
1182074715 22:27487854-27487876 CTATTACCCTGACCACCATGTGG - Intergenic
1182074784 22:27488174-27488196 CGTTTAACCTGACCTCCTCGGGG - Intergenic
1184431720 22:44445019-44445041 CCACTAGCCTGAGCTCCAGGAGG - Intergenic
1184474688 22:44714177-44714199 TGATGATCCTGAACTCCGGGTGG + Intronic
963509472 3:146229318-146229340 ATATTTGCCTGACCTCCAGGGGG + Intronic
965694795 3:171396535-171396557 CTTTTATACTGATCTCCAGGTGG + Intronic
966448985 3:180036720-180036742 CGAGTACCCGGAGCTCCAGGGGG - Exonic
969254990 4:5995403-5995425 GAATTATCCTGACCTGCAGCAGG - Intergenic
977673683 4:99724599-99724621 CAATCATCCTCACCACCAGGAGG + Intergenic
981931066 4:150189877-150189899 TTAGTGTCCTGACCTCCAGGTGG - Intronic
982599657 4:157431269-157431291 CGAATCTTCTGACTTCCAGGTGG - Intergenic
985235938 4:187874358-187874380 TGATGATCCTGACCTCCTGTAGG - Intergenic
987091532 5:14512135-14512157 CCATTATCCTCCCCCCCAGGAGG + Intronic
990695458 5:58411653-58411675 TGTTTTTCCTGACCTCTAGGTGG + Intergenic
1003395129 6:5746570-5746592 ATATTGTCCTGGCCTCCAGGTGG + Intronic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1018419545 6:163630251-163630273 GGCTGCTCCTGACCTCCAGGAGG - Intergenic
1022517211 7:30983758-30983780 TGATCATCCTGGCCACCAGGTGG + Intronic
1024889600 7:54185068-54185090 GGACTCTCCTGACCCCCAGGAGG - Intergenic
1030108184 7:106004596-106004618 CGATTCTCCTGACCCCCATATGG - Exonic
1031301853 7:120069736-120069758 CCATTTTCCTGAGATCCAGGTGG - Intergenic
1036017779 8:4805154-4805176 CGAGTAAACTGACATCCAGGGGG - Intronic
1039437912 8:37573371-37573393 CCCTTCTCCTGACTTCCAGGGGG + Intergenic
1049031408 8:140040757-140040779 CAATTATCATGACCTCAAGAAGG + Intronic
1049253099 8:141599564-141599586 CGAACATGCAGACCTCCAGGAGG + Intergenic
1189066548 X:37815864-37815886 TGATTATCCTGTTTTCCAGGTGG + Intronic