ID: 1156070201

View in Genome Browser
Species Human (GRCh38)
Location 18:33197481-33197503
Sequence TTTCACACCTGGAATTATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156070201 Original CRISPR TTTCACACCTGGAATTATAA TGG (reversed) Intronic
901559749 1:10060683-10060705 TTTAACACCTTGACTTCTAACGG + Intronic
906692751 1:47803335-47803357 TTTCAGGCCTGAATTTATAATGG - Intronic
908372735 1:63499573-63499595 TTTTACATCTGTATTTATAAGGG - Intronic
908858771 1:68459642-68459664 TTTAACAACTGGATTTAGAAAGG + Intergenic
909156982 1:72090837-72090859 TTTCACATCTGGAAAAACAAGGG + Intronic
909559742 1:76996800-76996822 TTTCTCACTTGGAATTCTATGGG - Intronic
910347102 1:86251950-86251972 TTTCCCCCATTGAATTATAATGG - Intergenic
910854112 1:91677625-91677647 TACCACTCCTGGAACTATAATGG - Intergenic
911203176 1:95066908-95066930 TTTCACAGCTGGAATAATTAAGG + Intronic
911304643 1:96217943-96217965 TATCACAAATGGGATTATAAAGG + Intergenic
911869135 1:103070470-103070492 TTTTACAAATGGAATTATACTGG - Intronic
913668188 1:121069810-121069832 TTTAACACAAGGAATTATACAGG - Intergenic
914019933 1:143857247-143857269 TTTAACACAAGGAATTATACAGG - Intergenic
914658431 1:149765156-149765178 TTTAACACAAGGAATTATACAGG - Intergenic
915874995 1:159603033-159603055 TTTTACATTTTGAATTATAATGG + Intergenic
916082342 1:161242289-161242311 TTTCTCACCTGGAAAAAAAAAGG + Intergenic
916998289 1:170326050-170326072 TTTCCACCCTGTAATTATAAAGG - Intergenic
919712562 1:200742216-200742238 TTTCACACCTGCAGATAAAACGG - Intronic
920317424 1:205087639-205087661 TTTCACACCTGGTTTCCTAATGG + Exonic
922031119 1:221800036-221800058 TGTGAAACCTGGAATTAAAATGG - Intergenic
922829243 1:228542953-228542975 TATGACACCTGGAATTCTAATGG - Intergenic
1063341239 10:5265584-5265606 TTTGACTCCTGGATCTATAAAGG - Intergenic
1063756140 10:9011079-9011101 TGGCATACTTGGAATTATAACGG - Intergenic
1064646841 10:17468484-17468506 TTTCACAGCTGGAATAGAAAGGG - Intergenic
1066587889 10:36958063-36958085 TTTCACACATGCAATTATGAAGG + Intergenic
1068229534 10:54153841-54153863 TTGCACACCCTGATTTATAAAGG + Intronic
1068503890 10:57874932-57874954 TTTAACACCTGGAATTGTAGAGG - Intergenic
1068761685 10:60718463-60718485 TTACTCACCTGAAATTAAAAAGG + Intronic
1069100752 10:64317664-64317686 ATACACACCCCGAATTATAATGG + Intergenic
1072039686 10:91595008-91595030 TTTTGCACATGGAAATATAAAGG - Intergenic
1072930073 10:99654684-99654706 GATCACACCTGGAAGTAGAAAGG + Intergenic
1073871420 10:107869253-107869275 TTTCACACTTGCAATTGGAAGGG - Intergenic
1077730149 11:4721879-4721901 TTTGGCCCCTGGAATCATAATGG + Intronic
1077948991 11:6933872-6933894 TTTTACACATGGTATTATCACGG - Intronic
1078440563 11:11362714-11362736 TTTCCCACCAGGAATGATGAAGG - Intronic
1079782915 11:24631620-24631642 TTTCACACCTGTGTTTATCAGGG + Intronic
1080396075 11:31891182-31891204 TTTCACAAATGGAATAATAAAGG + Intronic
1085525971 11:77164188-77164210 TATCTCACCTGGAATTCTTAAGG + Intronic
1085900214 11:80689910-80689932 TTTCACACATGCAATTATGAAGG - Intergenic
1086020105 11:82217331-82217353 TTTCTCACCTGCATATATAAAGG + Intergenic
1087392914 11:97561439-97561461 CTTCACACCTGAAATTCTAATGG + Intergenic
1087634233 11:100685752-100685774 TTTAACACTTGGAGTTAAAATGG + Intergenic
1089194146 11:116682667-116682689 TTTCATCCCTGGAAGTAGAATGG - Intergenic
1091321021 11:134651519-134651541 TTTCTCACCTGAAATCATGAAGG - Intergenic
1092355487 12:7791385-7791407 TTTAACATTTGAAATTATAAAGG - Intronic
1092902679 12:13074731-13074753 TTTCATACCTGGGATCCTAAGGG + Intronic
1094304361 12:29000962-29000984 TTTCCCACATGGAAGTTTAAGGG - Intergenic
1096048437 12:48585247-48585269 TTTCAGACCTTGCATTCTAATGG + Intergenic
1101544681 12:105701064-105701086 TTTCACACCCTGAAAAATAATGG - Intergenic
1102073784 12:110043903-110043925 TTTCACATCTGAAATTTTCAAGG + Intronic
1107585511 13:41843307-41843329 TTTCACACCTGTTTTTCTAAGGG - Intronic
1109326502 13:60873872-60873894 TTGCACACTTGAAATCATAATGG + Intergenic
1109982920 13:69934141-69934163 TTTAACACCTAGAATTATAGTGG + Intronic
1109991671 13:70066715-70066737 TGTCAAAGCTGGAATTATAACGG + Intronic
1110961901 13:81637206-81637228 TTTCAAACCTGTAATTTTTAAGG + Intergenic
1111405597 13:87800999-87801021 TTTTTCACTTGGAATTATATAGG - Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1116324942 14:43520923-43520945 TTTCTCAACTCTAATTATAAGGG - Intergenic
1116559229 14:46356884-46356906 TTTCACACATGTAATTGAAAAGG + Intergenic
1121072632 14:91038376-91038398 TTCCACATCTGGAGTTGTAAAGG + Intronic
1121129951 14:91437031-91437053 TTTCACATCTGTATTTATGAGGG + Intergenic
1124260043 15:28181168-28181190 TTTCACCCAGGGAATCATAAAGG - Intronic
1124580408 15:30948998-30949020 TTTTACATCTGTAATCATAAGGG - Intronic
1126338107 15:47608914-47608936 TTTTACTCCTTGAATTATTACGG + Intronic
1126447700 15:48767456-48767478 TTTCACACCTGGAAACAGAGCGG + Exonic
1132133885 15:99313301-99313323 GCTCACACCTGGAATTGAAAGGG + Intronic
1133368947 16:5233601-5233623 TTTCAAACCTGGAATCACACTGG + Intergenic
1134347417 16:13403734-13403756 TTTCAGACCCTGAATTAGAAAGG - Intergenic
1139160356 16:64498848-64498870 TTTATCACCTGGACTTATAGTGG + Intergenic
1139232591 16:65298961-65298983 TTTCTCCCATGGAATTAGAATGG - Intergenic
1140340614 16:74156035-74156057 TTTCACATGAGGAAGTATAAGGG - Intergenic
1144184488 17:12784026-12784048 TTTGATACCTGCAAGTATAAAGG + Intergenic
1148905007 17:50906448-50906470 TTTCATTGCTGGAATTATGAGGG - Intergenic
1149812900 17:59695125-59695147 TTTCTCATCATGAATTATAAAGG + Exonic
1150089359 17:62308609-62308631 TTTTACAAATAGAATTATAAAGG + Intergenic
1152459867 17:80436681-80436703 TTTTACATCTGTATTTATAAGGG + Exonic
1155376694 18:25166107-25166129 TTTCAAATCTGTATTTATAAAGG - Intronic
1155569591 18:27177424-27177446 TTTCACAGATGGAATTAAAGTGG - Intronic
1155629895 18:27880921-27880943 TATCACAACTGGATTTGTAAGGG - Intergenic
1156070201 18:33197481-33197503 TTTCACACCTGGAATTATAATGG - Intronic
1157708455 18:49829666-49829688 TTTTACATCTGTATTTATAAGGG - Intronic
1159425256 18:68276466-68276488 TTTGAAACCTGCAAATATAATGG - Intergenic
926189568 2:10718771-10718793 TTTCATAGCTGAATTTATAATGG - Intergenic
926448873 2:12978007-12978029 TTTGTTATCTGGAATTATAATGG - Intergenic
927260668 2:21086207-21086229 TTTCAAACTTGGAATCATCATGG + Intergenic
927428309 2:23005423-23005445 ATTCAGACCTGGAATTCTGAAGG + Intergenic
928444170 2:31318540-31318562 TTTCCCACATGAAATTGTAAAGG + Intergenic
930590441 2:53320685-53320707 TTTCACAACTGAGATCATAACGG - Intergenic
931682866 2:64767725-64767747 ATTCATACTTGGAATTACAAAGG + Intergenic
934621593 2:95813031-95813053 TTTCATACCAGGAATTCTCAGGG + Intergenic
937462308 2:122100178-122100200 TTTCAAAAAAGGAATTATAAAGG + Intergenic
942385138 2:175434759-175434781 TTTCAGATCTTGAATGATAATGG - Intergenic
947453469 2:230230333-230230355 TTTCAGACCTTGCATTCTAATGG - Intronic
948441641 2:237994839-237994861 TTTCAAACAGCGAATTATAAAGG + Intronic
1174308072 20:49629071-49629093 TTTAACCCCTGGAATTAAAGGGG - Intergenic
1174508425 20:51032177-51032199 ATTCACACCTGTAATTCCAACGG + Intergenic
1175840260 20:62022108-62022130 TTTCCCAGCTGTATTTATAATGG + Intronic
1176151578 20:63594119-63594141 TTACACATCTGGAATTATTTGGG + Intronic
1177793355 21:25744622-25744644 TTTCACACTTTGAATTCAAAAGG - Intronic
1180115006 21:45696951-45696973 TTTCACACCTGCCTTTCTAAAGG - Intronic
1180747607 22:18101715-18101737 TTTAAGACCTGGCATTACAATGG + Exonic
1182762811 22:32736148-32736170 TTTCACACATGAAATACTAATGG + Intronic
949463021 3:4314224-4314246 TTTCTCACCTGAAAGTACAAAGG - Intronic
951631367 3:24724952-24724974 TTTTACACCTGGAGTCATATGGG - Intergenic
955288766 3:57671004-57671026 TTTCTGACCTGGAATTATTTTGG - Intronic
957264260 3:77941475-77941497 TTTCCCACCAGGAATACTAAAGG + Intergenic
957883951 3:86258316-86258338 TCTGAAACCTGGAATTAGAATGG - Intergenic
962067584 3:131998147-131998169 TACCACACCAGGAATTTTAAAGG + Intronic
963738444 3:149049477-149049499 TTGAACAATTGGAATTATAAAGG + Intronic
965145616 3:164898611-164898633 TTTCACAGTTGAAATTATAATGG + Intergenic
967146626 3:186612105-186612127 TGTCACACTTGGAATTGTCAAGG + Intergenic
969725784 4:8917334-8917356 GTTCACACCTGGCACTATCAGGG + Intergenic
970596782 4:17607746-17607768 TTTCACACAAAGATTTATAAAGG + Exonic
971956888 4:33431959-33431981 TTTCACAGCTGGAATGTAAATGG - Intergenic
972135585 4:35889047-35889069 TTTCTTACATAGAATTATAATGG - Intergenic
972368876 4:38402214-38402236 CATCACACCTGGAACTAGAAAGG - Intergenic
972668523 4:41191436-41191458 TTTCACACTTGGATTTTTAAAGG - Intronic
972919839 4:43925055-43925077 TTTGGAAGCTGGAATTATAAGGG + Intergenic
973162384 4:47033487-47033509 TTTCACAAGTGGAATAAAAATGG - Intronic
975033552 4:69654737-69654759 TTTTACACCTAGAAATATATTGG - Intergenic
976314533 4:83645163-83645185 TTTCAAAACTGGAATTATCCAGG - Intergenic
979807469 4:124992565-124992587 TTTTACATCTGTACTTATAAAGG - Intergenic
979882126 4:125972668-125972690 TCTAAGACGTGGAATTATAAAGG - Intergenic
981507127 4:145514636-145514658 CTTCACAGCTGGACTTGTAAAGG - Exonic
983799990 4:171915752-171915774 TTTCACAGCTGAAATTTTAAGGG + Intronic
984408389 4:179364248-179364270 TTTCACACCTGGAATTCGTCGGG - Intergenic
987813055 5:22864173-22864195 TTTCTCACCTGTAATATTAAAGG - Intergenic
987966482 5:24882859-24882881 ATTGACAATTGGAATTATAATGG - Intergenic
990131873 5:52596015-52596037 TTTCACTCCTGGAGTTCGAATGG - Intergenic
992126016 5:73642304-73642326 TTTTACACCTGGAAATATTTAGG - Intronic
992146378 5:73853823-73853845 TTTAACAACTGGAAAAATAATGG + Intronic
993165376 5:84347309-84347331 TTTCAAACCTTGCATTATGAAGG + Intronic
997715897 5:136042576-136042598 TTTCATCCCTGAACTTATAAGGG - Intronic
1000828836 5:166078751-166078773 TTTCAAAGCTGGAATTTTTAGGG - Intergenic
1003019388 6:2496622-2496644 TTTCCCAGCAGGAATTAAAACGG - Intergenic
1004720674 6:18265142-18265164 TTACACCCCTGTAAATATAAGGG + Intergenic
1005328147 6:24721552-24721574 TTCGACACCTGGAATTTAAACGG + Intergenic
1010226850 6:73497956-73497978 TTTTAAACCTGGGGTTATAATGG + Intronic
1011015508 6:82749881-82749903 TTTCACATCTGTAATTACTAAGG - Intergenic
1011215996 6:85006176-85006198 TTTGACAGCAGGGATTATAAAGG - Intergenic
1011485342 6:87834981-87835003 TTTCAGACCTTCAATTACAATGG - Intergenic
1013979605 6:116114130-116114152 TTTCACAGCTTGAATTGTTAGGG - Intronic
1014101131 6:117513225-117513247 ATTCACACATGGAAAGATAAAGG + Intronic
1014156432 6:118115333-118115355 GTTGACACCTGGAAGTAGAAGGG + Intronic
1014578991 6:123110956-123110978 TTGAACAGCTGGCATTATAAGGG + Intergenic
1015243912 6:131056164-131056186 TTTCACACAAAGATTTATAAAGG + Intronic
1016254091 6:142083078-142083100 TTTCACACATTGAATTAGAAAGG - Intronic
1017466648 6:154700212-154700234 TTTTTCACCTTGAATTCTAAAGG + Intergenic
1018365219 6:163113071-163113093 CTTCACAACTGGAACTAAAAAGG + Intronic
1026669290 7:72373919-72373941 TTTCTCACGTGGAATCATGAAGG + Intronic
1027435260 7:78157959-78157981 TTTCACTCCTGAATTTATCAAGG + Intronic
1027771752 7:82415922-82415944 CCTCACACCTGTAATTCTAAAGG - Intronic
1032305285 7:130728183-130728205 TCTTAAACATGGAATTATAAAGG - Intergenic
1032500327 7:132395127-132395149 TTTCACACCTGGAAATAATGGGG + Intronic
1033921101 7:146393253-146393275 CTTCCCACCTGGAAACATAATGG + Intronic
1034494457 7:151411272-151411294 TTTCACACCTGGATGTGCAATGG - Intergenic
1036014075 8:4761459-4761481 ATTCACACTAGAAATTATAAAGG - Intronic
1041962022 8:63628987-63629009 TTTTCCACTTGAAATTATAATGG - Intergenic
1042020105 8:64363791-64363813 CTTCACAGCTGGAATTATTAGGG + Intergenic
1043775224 8:84258866-84258888 GTTCACACCTGGGAATATTAAGG - Intronic
1043988559 8:86723433-86723455 TTTAACAACTGAAAATATAAAGG + Intronic
1044826380 8:96201833-96201855 TTTCACAGCTGGAAAAATGATGG - Intergenic
1046807706 8:118498625-118498647 GTTCACACCTAGAATTTTCATGG + Intronic
1047091753 8:121582952-121582974 TTTCATACATGGTATTATGATGG + Intergenic
1047141526 8:122146089-122146111 TTTCACACTTTGAATATTAAGGG - Intergenic
1047703403 8:127473049-127473071 TTTGACACATGGAATTCTTAGGG + Intergenic
1048025973 8:130586964-130586986 TTTCCCTTTTGGAATTATAAGGG - Intergenic
1048461989 8:134628641-134628663 ATACACACATGGTATTATAATGG - Intronic
1048562142 8:135551672-135551694 TTTTACATCTGTAATTATGAAGG + Intronic
1050319352 9:4435253-4435275 TTTCATACTCAGAATTATAATGG + Intergenic
1050345684 9:4683731-4683753 ATTCACATGTGAAATTATAAGGG + Intronic
1050351280 9:4742563-4742585 TTCCACACCAGAAAGTATAAAGG - Intergenic
1051385908 9:16508562-16508584 CTTCACACCTGAATTTATTATGG + Intronic
1052237498 9:26229534-26229556 TTTCCCACCTGGAGTTTTAATGG + Intergenic
1052389292 9:27859615-27859637 TTTAAGACCTTGAATTATACTGG + Intergenic
1052642571 9:31188397-31188419 TTTCCCACCTGGAGATATCATGG + Intergenic
1053321823 9:37105387-37105409 TTTCACAGGTGGAATAATAAGGG + Intergenic
1055145970 9:72935228-72935250 TTTCAGAACTGGAATTTTCAGGG + Intronic
1055482149 9:76719348-76719370 ATTCACAACTGGAATTCAAATGG + Intronic
1059572817 9:115458795-115458817 TTGCAAACATGAAATTATAAAGG + Intergenic
1059663350 9:116423280-116423302 TTTCCCAGCTTGAATGATAAGGG - Intergenic
1060780728 9:126410556-126410578 TTTCACTCCTGTAATTATTTAGG - Intronic
1185696867 X:2201517-2201539 TTACAGACCTGGAATCATACAGG + Intergenic
1189115718 X:38340342-38340364 TTTTCCACTTGAAATTATAATGG + Intronic
1190280808 X:48928515-48928537 TTTCCCCCCTGAAATTAAAATGG - Intronic
1191100870 X:56726873-56726895 TTTGAAACCTGGAATAATAAAGG + Intergenic
1192236463 X:69299386-69299408 TTTCATGCTTGGAATTCTAATGG - Intergenic
1193524625 X:82573711-82573733 TTTAACACCAGGAACTACAAGGG + Intergenic
1194818698 X:98478726-98478748 AATCACACCTGGAATAACAAAGG - Intergenic
1196070206 X:111512451-111512473 TTTCAGCTCTGGAATTATATAGG + Intergenic
1197457182 X:126691677-126691699 TTCCACACCTGAATATATAAAGG - Intergenic
1199511757 X:148630452-148630474 TTTCCCACCTGCAACTATCAGGG - Intronic