ID: 1156073070

View in Genome Browser
Species Human (GRCh38)
Location 18:33237171-33237193
Sequence CACTGGGCTTGGAATGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 283}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156073070_1156073075 5 Left 1156073070 18:33237171-33237193 CCATCTTCATTCCAAGCCCAGTG 0: 1
1: 0
2: 1
3: 24
4: 283
Right 1156073075 18:33237199-33237221 ACTCTACAACCCTAGCTGTGTGG 0: 1
1: 0
2: 1
3: 11
4: 65
1156073070_1156073080 19 Left 1156073070 18:33237171-33237193 CCATCTTCATTCCAAGCCCAGTG 0: 1
1: 0
2: 1
3: 24
4: 283
Right 1156073080 18:33237213-33237235 GCTGTGTGGAGCCTGGGTCAAGG 0: 1
1: 1
2: 9
3: 42
4: 356
1156073070_1156073077 13 Left 1156073070 18:33237171-33237193 CCATCTTCATTCCAAGCCCAGTG 0: 1
1: 0
2: 1
3: 24
4: 283
Right 1156073077 18:33237207-33237229 ACCCTAGCTGTGTGGAGCCTGGG 0: 1
1: 1
2: 5
3: 104
4: 698
1156073070_1156073076 12 Left 1156073070 18:33237171-33237193 CCATCTTCATTCCAAGCCCAGTG 0: 1
1: 0
2: 1
3: 24
4: 283
Right 1156073076 18:33237206-33237228 AACCCTAGCTGTGTGGAGCCTGG 0: 1
1: 1
2: 4
3: 25
4: 147
1156073070_1156073081 24 Left 1156073070 18:33237171-33237193 CCATCTTCATTCCAAGCCCAGTG 0: 1
1: 0
2: 1
3: 24
4: 283
Right 1156073081 18:33237218-33237240 GTGGAGCCTGGGTCAAGGATTGG 0: 1
1: 0
2: 3
3: 21
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156073070 Original CRISPR CACTGGGCTTGGAATGAAGA TGG (reversed) Intronic
900703198 1:4060678-4060700 CTCTGGGCTTGGCCTGCAGAAGG + Intergenic
900827004 1:4935009-4935031 CTCCGGGCTTGGCATGGAGAAGG + Intergenic
902265411 1:15259938-15259960 CACTTGGCATGGCATGATGAGGG + Intronic
902284391 1:15397380-15397402 CACTGGGCTTAGAATGCAAAAGG - Exonic
903185337 1:21625806-21625828 CACAAGGCTTGGCATGAAGCAGG + Intronic
904890609 1:33776771-33776793 CAAGAGGCTTAGAATGAAGAAGG + Intronic
905309036 1:37036908-37036930 CACTGGACTTGGAAGGCAGCTGG + Intergenic
906204648 1:43980251-43980273 CACTGGGCATGGCAGGAAGGGGG - Intronic
906461935 1:46041209-46041231 CACTGGGCCTGGTGTGTAGAGGG - Exonic
906688967 1:47780196-47780218 CACTGGGCTTGGAATGTCAGAGG + Intronic
907919037 1:58895893-58895915 CAGTGGGCTTGGGGTGAAGATGG + Intergenic
910018325 1:82554006-82554028 CATTGGCCTTGGATTGCAGAAGG + Intergenic
911645125 1:100329643-100329665 GACTGAGGTGGGAATGAAGAAGG - Intergenic
912858004 1:113189102-113189124 CTTTGTGCTTGGAATGAAGGAGG + Intergenic
915312790 1:155012702-155012724 CCCTGGCCTTGCAATGAAGAGGG + Intronic
915444616 1:155967616-155967638 CCCTGGGCCTGGAAGGGAGAAGG - Intronic
915518823 1:156429643-156429665 CACAGGCATTGGAAGGAAGAAGG - Intronic
917512535 1:175680246-175680268 AACAGGGCTTGGATTGAACATGG + Intronic
918029384 1:180789838-180789860 CTCTGGGGTAGGCATGAAGAAGG - Intronic
919811020 1:201408871-201408893 AACTGGGTTTTTAATGAAGAAGG + Exonic
921596955 1:217064909-217064931 CTCTGGGCTTTTAATGAGGAAGG + Intronic
921743261 1:218710070-218710092 CACTGGGCTTGAAATGAAAGAGG - Intergenic
921983836 1:221286781-221286803 AACTGGGGTTGGAATGACAAGGG + Intergenic
922487640 1:225988006-225988028 CACTGGGGCTGGACTGAATAAGG - Exonic
922889064 1:229046553-229046575 CGCAGGGCGTGGAAGGAAGAGGG - Intergenic
924718896 1:246605127-246605149 CAGTGTGCTTGGAATGAACAGGG + Intronic
1062890651 10:1057096-1057118 AGGTGGGCTTGGAATGCAGAGGG + Intronic
1068070044 10:52183837-52183859 CTCTGGGCTTGCAATGACTATGG + Intronic
1069719971 10:70543765-70543787 CACGGGGCCTGGTGTGAAGAAGG - Intronic
1070374346 10:75814685-75814707 CACTGGGCTTGATACCAAGAGGG - Intronic
1070704061 10:78624819-78624841 CACTGGGCTTGGGAAGGAGATGG - Intergenic
1072536626 10:96369234-96369256 CACTGGGCTTGGCATATAGTTGG - Intronic
1073008696 10:100343546-100343568 CCCAGGGCTTGGAAGGAGGATGG - Intergenic
1073290806 10:102412351-102412373 CACTAGGCTGGGACTGAGGATGG - Intronic
1076081951 10:127590330-127590352 CACTGGGGTTGGTTTGAAGATGG + Intergenic
1076804711 10:132849662-132849684 CCCTGGGCTGAGAGTGAAGAAGG + Intronic
1077066567 11:643705-643727 CACTGGGCTGGGCCTGAACATGG - Intergenic
1077650633 11:3968617-3968639 CACTGTGCTAGGCATGGAGATGG + Intronic
1077956063 11:7020810-7020832 CACTGGACCAGGAACGAAGAGGG - Intronic
1080638469 11:34143765-34143787 CACTGGGCCTGTCATGGAGAAGG + Intronic
1081492827 11:43580686-43580708 CACTTGGGCTGGAATGAGGAGGG + Intronic
1081821272 11:45997969-45997991 CACTGGGCTCGTAAGGAGGATGG + Intronic
1081934462 11:46895382-46895404 CACTAGGCCTGGAAAGTAGATGG - Intronic
1083058884 11:59848948-59848970 CACTGGCCAGGGAATGGAGAAGG - Intergenic
1083278421 11:61610774-61610796 AACTGGTCTTGGAAAGAAGCTGG + Intergenic
1084580574 11:70020530-70020552 CACTGAGCTGGGAAGGAAGAGGG - Intergenic
1084687323 11:70704112-70704134 CACAGGGCTCGGGAGGAAGAAGG + Intronic
1084955874 11:72691325-72691347 CCCTGGGCATGGAAGGAAGGAGG - Intronic
1085317315 11:75553431-75553453 TACAGGGCTTGGCCTGAAGATGG - Intergenic
1089649773 11:119905215-119905237 TACTTGGCTTGGAATGGACAGGG - Intergenic
1090081261 11:123614426-123614448 CATTGGGCTAGGACTAAAGACGG - Intronic
1090716269 11:129434028-129434050 CTCTGGGCTTGGAATAAAACAGG - Intronic
1091181041 11:133605041-133605063 CACTGTGCCTGGAAGAAAGAGGG + Intergenic
1092280843 12:7096708-7096730 CAGTGGGTTTGGCATGGAGATGG - Exonic
1092400912 12:8177734-8177756 CACTGTGTTAGGAATGACGAAGG + Exonic
1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG + Intronic
1097391104 12:59014391-59014413 CACTGTGCTTGGCAAGAAGTAGG + Intergenic
1098203870 12:68085211-68085233 GACTGAGCTGGGAATGAGGAAGG + Intergenic
1099259377 12:80358050-80358072 CACTGTGCTTGGAAAGCATAAGG + Intronic
1099585194 12:84505887-84505909 AACTGGGGCTGGAAGGAAGAGGG - Intergenic
1100330914 12:93581355-93581377 CACTGGGCTTGGTATAAAAGAGG - Intronic
1101046774 12:100814788-100814810 CACTTGGTTTGAAGTGAAGATGG - Intronic
1101111461 12:101490773-101490795 CTCTTGGCCTGGACTGAAGATGG - Intergenic
1101527691 12:105546729-105546751 CACTGGGATTGACATGAAAAGGG + Intergenic
1101778781 12:107817254-107817276 ACCTGGACTTGGAATGATGAGGG + Intergenic
1102241632 12:111328177-111328199 CACTGGGCCTGGAAGCAAAAGGG + Intronic
1103360996 12:120353508-120353530 CACAGGGCTTGGTATGAAGAAGG - Intronic
1106463090 13:29989843-29989865 ACCTGGGCTTGGCATAAAGATGG + Intergenic
1107297160 13:38921640-38921662 GCCTGGGTTTGGGATGAAGAGGG - Intergenic
1110256106 13:73435652-73435674 CACTGGGCTTATAGTGAAGAGGG - Intergenic
1110367677 13:74705825-74705847 CACATGGCTAGGGATGAAGATGG - Intergenic
1111511993 13:89278443-89278465 GCCTGGGCTTGGAATGCAAATGG + Intergenic
1111580449 13:90215759-90215781 CTCTGGCCTTGGTAAGAAGATGG + Intergenic
1112990042 13:105502275-105502297 CACTTGGCTGGGAATTAAAAAGG - Intergenic
1118057741 14:62099318-62099340 CACTGGGGATGGAAAGAAGTGGG + Intronic
1118311145 14:64694049-64694071 CACTGGGGTTGGCAGGAAGCAGG + Intergenic
1119252869 14:73172011-73172033 CACAGGCCTTGCAATAAAGAAGG - Intronic
1119383774 14:74244662-74244684 CTCTGTGCTTGGGAGGAAGAGGG + Intronic
1119848384 14:77847594-77847616 CACTGGCCCTGGTATGAAGTGGG - Intronic
1119921601 14:78451500-78451522 CAATGGGCTTGGAACCAGGATGG + Intronic
1120723125 14:87908599-87908621 CTCTGGGCGTGGAGTTAAGAGGG + Intronic
1121125717 14:91405410-91405432 CTGAGGGCTTGGAATGAAGTGGG - Intronic
1121822045 14:96978380-96978402 CCTTGGGCTTGGAGTGAAAAGGG - Intergenic
1124955781 15:34359505-34359527 CACTGGGCTGGGAGGGAACAAGG - Intronic
1126187048 15:45840935-45840957 CTCTGGGCTTGTAAATAAGAAGG - Intergenic
1126344059 15:47674579-47674601 CACTGTGCTTGGAAGGGTGAGGG + Intronic
1126713075 15:51483345-51483367 ATGTAGGCTTGGAATGAAGACGG - Intronic
1127708098 15:61567154-61567176 CACAGTGCTTGGAATGTAGATGG - Intergenic
1129384675 15:75189396-75189418 GGCTGGGATTGGGATGAAGATGG + Intergenic
1130055198 15:80517798-80517820 CACTGTGATGGAAATGAAGAAGG - Intronic
1130249964 15:82293539-82293561 CACAGTGCTGGGAATGAATAGGG + Intergenic
1131253087 15:90843697-90843719 CCCAGGGCTTGGCATGAAGTAGG + Intergenic
1131390066 15:92040558-92040580 CACTGCTCTTGGAATGTGGATGG - Intronic
1131540611 15:93272060-93272082 CAGCGGGGTTGGAATGAAGCAGG + Intergenic
1132971954 16:2693495-2693517 CACTGGGCTCGGCCTCAAGACGG - Intronic
1133056672 16:3148869-3148891 CCCTGGGATTGGAAGGCAGAGGG + Intronic
1133255030 16:4511537-4511559 CACTGGGCTAGGGACGAGGAAGG - Exonic
1137236615 16:46623427-46623449 AACTGGGCTGGGAGAGAAGATGG - Intergenic
1137564445 16:49524553-49524575 CCCTGGGCCTGGCATGGAGAAGG + Intronic
1137566675 16:49537744-49537766 CACTGGGCTTGGCCTCAAGAAGG - Intronic
1137920130 16:52478801-52478823 GACTGGGCTTTGCAAGAAGAAGG + Intronic
1138255872 16:55559694-55559716 AACTGGGATTGGAATCAAAATGG - Intronic
1138721962 16:59092636-59092658 CACAGTGCTTGGTATGCAGATGG - Intergenic
1140529891 16:75656096-75656118 CAGTGTGATTGGAATGCAGAGGG + Intronic
1140630806 16:76849728-76849750 CACTGAGCTTTGAATGTTGAGGG + Intergenic
1140985684 16:80156287-80156309 CACTGGGCAAAGAAGGAAGAAGG + Intergenic
1141409814 16:83825381-83825403 CACTGGGGTTGCAGTGAAGCAGG + Intergenic
1141968740 16:87465261-87465283 AACTGGGCCTGGCATGAAGCAGG + Intronic
1203141760 16_KI270728v1_random:1771611-1771633 CACTGGGGCTGGGATGATGATGG - Intergenic
1143360441 17:6364943-6364965 CACTGTGCTTGGCATAAAGTCGG + Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1146529924 17:33599762-33599784 CCCTGTGCTTGGGATGAAGAAGG + Intronic
1147262064 17:39214503-39214525 CACTGGGACGGGAATGGAGAGGG + Intronic
1150421825 17:65043573-65043595 CACTGCGCTTGGACTGAATGTGG + Intronic
1150505894 17:65698873-65698895 CCCTGGGCTTGCACTGAAGAGGG - Intronic
1150995052 17:70307554-70307576 GACTGGGCTGGGGGTGAAGAAGG - Intergenic
1151598419 17:75091644-75091666 TGCTGGGCTTGGCAGGAAGAGGG + Intronic
1152459993 17:80437464-80437486 CACTGGGCTTGGGGTTAAGTGGG + Exonic
1155174938 18:23293614-23293636 CACTGAGCTTGAAATAGAGAAGG - Intronic
1155409093 18:25522632-25522654 AAATGGACTGGGAATGAAGAGGG - Intergenic
1155424782 18:25695567-25695589 CACTGGGCTTTCACTGATGAGGG - Intergenic
1156073070 18:33237171-33237193 CACTGGGCTTGGAATGAAGATGG - Intronic
1156287516 18:35713286-35713308 AACTGTGCATGGTATGAAGAAGG - Intergenic
1158220612 18:55146680-55146702 CACAGTGTTTGGAATGAAGTGGG - Intergenic
1158406354 18:57163216-57163238 AACTGGGGCTGGAATGAAGTGGG - Intergenic
1158674681 18:59507439-59507461 CCCTGGGCATGGCATGAGGAAGG - Intronic
1160402452 18:78620810-78620832 CACTGGGCTTGGGGAGAACATGG + Intergenic
1161935872 19:7371956-7371978 CACTTGTCTTGGGATGAGGAAGG - Intronic
1162148944 19:8631393-8631415 GGCTGGGCTTGGGATGAACAGGG + Intergenic
1162460212 19:10810278-10810300 GACTGGGCTTAGAAGGAAGTAGG - Intronic
1162722844 19:12672766-12672788 CACTGGGCTGGGAAGGCACAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164224441 19:23229704-23229726 CTATGGGTTTGTAATGAAGAGGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1166563628 19:43749775-43749797 CCCTGGGCTGGGAATCAGGAGGG - Intronic
1166774442 19:45303685-45303707 CACTGGGCCTGGCATGGAGTAGG - Exonic
1167135592 19:47613401-47613423 GCCTGGGCTTGGAAGGCAGAGGG + Intronic
925214704 2:2084496-2084518 CCCTGGGCTAGGAGTGGAGAGGG + Intronic
925342810 2:3148651-3148673 CACTGCTCTTGGAATGAGGCAGG - Intergenic
925717972 2:6802342-6802364 CACTGAGCTTCATATGAAGATGG + Intergenic
926319581 2:11739727-11739749 TACTGGGCTTGCAAAGAAGCAGG + Intronic
927484053 2:23476983-23477005 AGCTGGGCCTGGAATGAAGCAGG + Intronic
928919868 2:36515540-36515562 AGCTGATCTTGGAATGAAGAGGG - Intronic
930386852 2:50707784-50707806 CTCTAGGCTAAGAATGAAGACGG - Intronic
930681780 2:54264487-54264509 CAGGGAGCTTAGAATGAAGAAGG + Intronic
930879553 2:56255655-56255677 CATTGGGCTGGGAATGGAGGAGG + Intronic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
933336759 2:80968232-80968254 GCCTTGGCTTGGAATGTAGAGGG - Intergenic
933767031 2:85716681-85716703 CACAGGACTTGGAAGGCAGAAGG - Intergenic
934769541 2:96899100-96899122 CCCTGGGCTTGCAGTGGAGATGG + Intronic
938388780 2:130887824-130887846 CACTGTGCTGGGAAGGAGGATGG + Intronic
939200311 2:139025385-139025407 CACAGGGCTTGAGATAAAGATGG - Intergenic
940734078 2:157429244-157429266 CAATGGGCTTGGCATGTACAAGG - Intronic
943176776 2:184486011-184486033 CACTGGCATTGGAGTGAAGAAGG + Intergenic
943267034 2:185745150-185745172 CACTGGGCACAGAATGAAGTGGG - Intronic
945514294 2:210743605-210743627 CACTGGGCTGGGAAGGTAGGTGG + Intergenic
945517373 2:210779133-210779155 CACTAGCCTTGGAATGAAGCTGG + Intergenic
945985387 2:216349621-216349643 GGCTGGGCTTGGAATGGTGATGG + Intronic
946061084 2:216942075-216942097 CTCTGTGCCAGGAATGAAGATGG - Intergenic
948551636 2:238776502-238776524 CACTGAGCATGGAAAGAGGAAGG + Intergenic
948551639 2:238776542-238776564 CACTGAGCATGGAAAGAGGAAGG + Intergenic
948551642 2:238776582-238776604 CACTGAGCATGGAAAGAGGAAGG + Intergenic
948551674 2:238776942-238776964 CACTCAGCATGGAAAGAAGAAGG + Intergenic
948551677 2:238776982-238777004 CACTGAGCATGGAAAGAGGAAGG + Intergenic
948551696 2:238777182-238777204 CACTGAGCATGGAAAGAGGAAGG + Intergenic
948551707 2:238777302-238777324 CACTGAGCATGGAAAGAGGAAGG + Intergenic
948551734 2:238777582-238777604 CACTGAGCATGGAAAGAGGAAGG + Intergenic
1170422951 20:16210652-16210674 AACTGGGTTTGGCATGAAGGAGG - Intergenic
1170545475 20:17432330-17432352 CACGGAGTTTGAAATGAAGACGG - Intronic
1172834215 20:37862658-37862680 CAGAGGGGTGGGAATGAAGATGG - Intronic
1173203411 20:40970599-40970621 CACTGAGCATGGAATCAAAATGG + Intergenic
1173537986 20:43830369-43830391 CACTGGGCATGGAAGGAGGGAGG - Intergenic
1174425565 20:50429685-50429707 CACGGGGCTTGGAACAAAGTTGG + Intergenic
1175092457 20:56515787-56515809 CACTGGGCTTTGAATTAACTTGG - Intronic
1175180808 20:57145779-57145801 CACTGGGGTAGGAGTGAAGAGGG - Intergenic
1183349619 22:37327606-37327628 CATTGGACTGGGAATAAAGAAGG - Intergenic
1183353800 22:37348116-37348138 CAATAGACTTGGAATGAGGAGGG - Intergenic
1183405268 22:37627445-37627467 CCCTTGGCTCTGAATGAAGAGGG - Intronic
1183441581 22:37825780-37825802 GACTGAGCTTGGAACCAAGAAGG - Intergenic
1184848423 22:47103217-47103239 GGCTGGGATTAGAATGAAGAAGG + Intronic
951731157 3:25811867-25811889 CAATGAACTTGTAATGAAGATGG + Intergenic
952543936 3:34398005-34398027 TACTGGGCCTGGAATGTAGTTGG - Intergenic
953137190 3:40191316-40191338 CACAGGGCTGGGAATGAGCAGGG - Intronic
954295987 3:49674662-49674684 CACTGGGGTGGGAAGGAAGGGGG + Intronic
955874237 3:63473447-63473469 CACAGTGCTTGGCATGAAGTTGG - Intronic
956013931 3:64861213-64861235 CACTGGAGTTGGAATCAAGGAGG + Intergenic
957973252 3:87410026-87410048 CAATGGGCTTGGCATCAGGAGGG - Intergenic
959738076 3:109684187-109684209 CACTGGGTTTTGACTGAGGAGGG - Intergenic
961559888 3:127721439-127721461 CTTTGGGCTTGAAATGAAGTGGG - Intronic
961749735 3:129088125-129088147 AACTGGGCTGGGAGAGAAGACGG - Exonic
962166590 3:133055660-133055682 CAGTGGGCATGGAAAGAAAAAGG - Intronic
962240008 3:133744291-133744313 CGCAGGGCATGGAAAGAAGATGG - Intergenic
962600601 3:136988196-136988218 CACTGGTCTTGGATTGGAAAGGG - Intronic
964233321 3:154496127-154496149 CACAGTGGTAGGAATGAAGAGGG - Intergenic
964421671 3:156510438-156510460 CTCGGGGCTGGGAAGGAAGAGGG - Intronic
964521258 3:157571011-157571033 CTCTGTGCTATGAATGAAGACGG + Intronic
966585911 3:181624243-181624265 CACTGCGATAGGAATGGAGAAGG - Intergenic
967480686 3:189969608-189969630 ATCTGGGCTTTGAAGGAAGAGGG - Intronic
968056936 3:195698906-195698928 CACTGGTCTTGGGAGTAAGACGG - Intergenic
969360496 4:6660360-6660382 CACTGGGACTGGGAGGAAGAAGG + Intergenic
970389036 4:15588697-15588719 CACTGGGCTTGGAAGTTATAAGG + Intronic
970852912 4:20623297-20623319 CTCTGGTCTTGGTATGAACAGGG - Intergenic
971253541 4:24993165-24993187 CACTGGGCTAGGGCTAAAGAAGG + Intergenic
971614066 4:28764638-28764660 GCCTGGGCATGGAGTGAAGAGGG - Intergenic
972557147 4:40193180-40193202 CACTGGGCTTGCAATGGAGGTGG + Intronic
972600243 4:40565714-40565736 CCCTGGGCTTGCTCTGAAGATGG - Intronic
972600408 4:40567004-40567026 CCCTGGGCTTGCTCTGAAGATGG + Intronic
976576564 4:86679074-86679096 CACAGAGCTTGAAATAAAGACGG - Intronic
976621559 4:87133595-87133617 AACAAGGCTTGGTATGAAGAAGG - Intronic
977938236 4:102829389-102829411 CACAGGACTAGGCATGAAGATGG + Intronic
979700809 4:123665924-123665946 TACTAGTCTTGGAATGAGGATGG + Intergenic
979722206 4:123914195-123914217 AACTGGGGTTGGAGTGAAGAAGG + Intergenic
983634034 4:169880049-169880071 CACTGGCCAGGGAATGGAGAAGG - Intergenic
985095512 4:186408919-186408941 CACTAGCCTTGAGATGAAGAAGG - Intergenic
986034167 5:3922446-3922468 CACTGGGTATGGAATAAAGGAGG + Intergenic
987628836 5:20440987-20441009 CATTTTGCATGGAATGAAGAAGG + Intronic
987790398 5:22558831-22558853 CAATGTGCTTTGAAAGAAGAAGG + Intronic
988498280 5:31762983-31763005 CACTGGACTTGAAATCAAGGTGG + Intronic
989389867 5:40888873-40888895 CACTGGGATGGGCATGAAGATGG - Intergenic
990227397 5:53670240-53670262 CATTGGACTTGGAATCTAGAAGG - Intronic
990370021 5:55108331-55108353 CCCTGTGATTGGAATGAATATGG + Exonic
990444245 5:55879241-55879263 CAGTGGTCTTGGTTTGAAGAAGG - Intronic
992551466 5:77864502-77864524 CACTGTGCTTGGCATGAAGCAGG + Intronic
993731010 5:91423034-91423056 CACTGGGCTTGGTACATAGAAGG + Intergenic
995240933 5:109884876-109884898 CGCTGGGCATGCTATGAAGATGG - Intergenic
995625767 5:114075011-114075033 CACAGGGATGGGAAGGAAGAAGG - Intergenic
996381101 5:122863374-122863396 CAGTGGGTTTGGAATGCAGTAGG + Intronic
996907214 5:128615032-128615054 CACTAGTCTTGGAATGTAGAAGG - Intronic
997333555 5:133085959-133085981 AACTGGGCTGGGAGTGAGGAGGG + Intronic
997518523 5:134507209-134507231 TCCTGGGCTTGGCATGGAGAAGG + Intergenic
999333262 5:150692865-150692887 CTCTGGGCTAAGAAGGAAGATGG + Intronic
1001643477 5:173262275-173262297 CACTGGGCTAGGAATCAGAAAGG - Intergenic
1003054056 6:2803227-2803249 CACTGGGCTTGTAAGGGTGACGG - Intergenic
1004478289 6:15994679-15994701 CAGTGGGCTTGGGAGGGAGATGG + Intergenic
1004894434 6:20133598-20133620 CACTGGGCTTTGTATAAGGAAGG - Intronic
1007125602 6:39423183-39423205 GGCTGGGCTTGGAAGGGAGAAGG + Intronic
1007454743 6:41968031-41968053 CACTTTAGTTGGAATGAAGATGG - Intronic
1007509124 6:42362028-42362050 TACTGTGCCTGGAAGGAAGAGGG - Intronic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1009926323 6:70125396-70125418 CTCTGAGCTCGGAATGAGGAGGG - Intronic
1012118774 6:95337876-95337898 CACTTAGCTTTGAATGTAGATGG - Intergenic
1012314894 6:97773836-97773858 CACTGAGGGTGTAATGAAGAGGG - Intergenic
1013556623 6:111262803-111262825 CCCTGGATTGGGAATGAAGAGGG + Intronic
1013614597 6:111830157-111830179 CACTGGGCTCTGCAGGAAGATGG - Intronic
1014390146 6:120852035-120852057 CACAGGTCTTCGAATCAAGAAGG + Intergenic
1014532065 6:122570199-122570221 CACTGGGATAGAAATGAAGCTGG + Intronic
1016175671 6:141075256-141075278 ACCTGAGCTTGGAATGGAGAGGG + Intergenic
1018027977 6:159820362-159820384 CACGGGGCTGGGAAGGAGGAGGG + Intronic
1018957502 6:168419915-168419937 CACTGGCCTCGTAATGCAGAAGG - Intergenic
1022305768 7:29145468-29145490 CACTGGGGTTGCAGTGAAGGTGG + Intronic
1022650849 7:32273025-32273047 CACTGGCTTTGAAATGGAGATGG + Intronic
1023611696 7:41978311-41978333 CACGGGGCTTGGAAGGCAAAGGG - Intronic
1024196611 7:47065251-47065273 CTCTGGCCATGGAATGCAGATGG - Intergenic
1025804398 7:64816855-64816877 CTCTGGGTTTGTAATGGAGAGGG + Intronic
1026300566 7:69094224-69094246 CAATGGGCTTGGAAATAAGTTGG - Intergenic
1027195702 7:76028641-76028663 CACTGCCCTTCGAGTGAAGAAGG - Exonic
1028431215 7:90749292-90749314 GACTGGGCATGGAGTGAAGAAGG - Intronic
1028840288 7:95422222-95422244 CACTGTTTTAGGAATGAAGAAGG + Intronic
1029889744 7:103915072-103915094 GGCTGGACTTGGAATCAAGAGGG - Intronic
1031082995 7:117276368-117276390 CTCTGAGCTTGGTGTGAAGAAGG - Intergenic
1032536944 7:132672310-132672332 TTCTGGGCTTGAAATGAACAGGG - Intronic
1034972206 7:155426451-155426473 CACTGGGCTTGGGACAAGGAGGG - Intergenic
1035729112 8:1842220-1842242 CACTGGGCTGGGAATACAGGAGG + Intronic
1036121446 8:6021629-6021651 CCCAGGGCTTAGAATGATGAGGG - Intergenic
1036567329 8:9948644-9948666 CACTGGGCTTGACAGGAAGTTGG + Intergenic
1039727535 8:40235353-40235375 TACTGAGCATGGAAAGAAGAAGG - Intergenic
1039806939 8:41008172-41008194 CAATGGGTTTGAAATGAAGAAGG + Intergenic
1040585731 8:48739334-48739356 CCCTGGGCTTGGTAAGAAAAAGG - Intergenic
1040739013 8:50548924-50548946 CTCTGGTCGTGAAATGAAGAAGG - Intronic
1041071816 8:54132606-54132628 AACTGGGGTTGGAATCAGGATGG + Intergenic
1041887669 8:62830635-62830657 GCCTGGGCTTGGAGTGGAGAGGG - Intronic
1045970505 8:108074849-108074871 CACTGTCCTTTGAATGAAGTGGG - Intronic
1046487852 8:114909771-114909793 TACTGCCCTTGGAATGAGGAAGG + Intergenic
1046501162 8:115078734-115078756 CACAAGGCTTGGCATGTAGAGGG + Intergenic
1046606324 8:116375414-116375436 GTCTGGGCATGGAATGGAGAGGG + Intergenic
1048180890 8:132193301-132193323 ACCTGGGCTTGGATGGAAGATGG - Intronic
1048739554 8:137539527-137539549 TAATGGGCTTGGAAGGTAGACGG + Intergenic
1049871204 8:144978756-144978778 CACTGGTGTGGGAAGGAAGAAGG + Intergenic
1050161116 9:2719121-2719143 CACTGGGCTGGGGAAGAGGATGG - Intronic
1051544473 9:18258916-18258938 CACTGGACTTGGTAAGATGAAGG - Intergenic
1051751418 9:20345920-20345942 CACTGGGCTTGGGATGGCAAGGG + Exonic
1051878728 9:21818087-21818109 ATCTGGGCTTTGAAGGAAGAGGG + Exonic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1053476674 9:38386973-38386995 CTCTGGTCCTGGGATGAAGATGG + Intergenic
1054709210 9:68494347-68494369 CACTGGGCTGGGACTGTAGGAGG - Intronic
1054869000 9:70031891-70031913 CACTGGAAATGGAATAAAGAGGG - Intergenic
1055951364 9:81732764-81732786 GAATGGGCTGGGAATGAGGAAGG + Intergenic
1056236605 9:84600778-84600800 AACTTGGCTTGGGGTGAAGAGGG - Intergenic
1057980509 9:99657484-99657506 CTTTGGGGTTGGGATGAAGAAGG - Intergenic
1058167479 9:101636352-101636374 CACAGTGCCTGGAATGAAGGAGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059522940 9:114961002-114961024 AAGTGGGGTTGGAATGAGGATGG - Intergenic
1060038509 9:120279990-120280012 CACTGGGAATGGAATAAACAAGG - Intergenic
1060973344 9:127751490-127751512 CACAGGGCCTGGAATGCAGCTGG - Intronic
1185573447 X:1152260-1152282 CACTGTGCCTGGAAGGACGAAGG + Intergenic
1190117293 X:47634598-47634620 CACTGGGCATGCAAGGGAGAGGG - Intergenic
1190936797 X:55005039-55005061 CACTGGGCTTGGCTTAGAGAAGG + Intronic
1192219021 X:69184443-69184465 CACTGGGAGTGGAGTGGAGAAGG - Intergenic
1192372516 X:70526254-70526276 CACTGGTGTTGGATTGAAAATGG + Intergenic
1192680026 X:73242509-73242531 CACAGGGCTTTGAGTGAACATGG + Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1192931477 X:75810757-75810779 CACTGGGCCTGAGATGAAGCAGG - Intergenic
1195481055 X:105345713-105345735 CCCTGGGCATGAAAAGAAGATGG - Intronic
1198089043 X:133309554-133309576 CATTGGGAATGGAATGCAGAAGG - Intronic
1199371525 X:147055588-147055610 TACTTTGCTTGGAATGAAAATGG - Intergenic
1200219282 X:154383228-154383250 CATTGGGCTTGGGATGGTGAGGG - Intergenic