ID: 1156078182

View in Genome Browser
Species Human (GRCh38)
Location 18:33305742-33305764
Sequence AAGGAGGAGAAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9210
Summary {0: 1, 1: 37, 2: 308, 3: 1660, 4: 7204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156078182_1156078193 23 Left 1156078182 18:33305742-33305764 CCCTCCTCCTTCTTCTCCTCCTT 0: 1
1: 37
2: 308
3: 1660
4: 7204
Right 1156078193 18:33305788-33305810 GCCTTGGCTTCTCCCCTAACAGG 0: 1
1: 0
2: 0
3: 8
4: 178
1156078182_1156078188 1 Left 1156078182 18:33305742-33305764 CCCTCCTCCTTCTTCTCCTCCTT 0: 1
1: 37
2: 308
3: 1660
4: 7204
Right 1156078188 18:33305766-33305788 CTGAAGCCCCACAGACAAAGTGG 0: 1
1: 0
2: 3
3: 27
4: 181
1156078182_1156078195 26 Left 1156078182 18:33305742-33305764 CCCTCCTCCTTCTTCTCCTCCTT 0: 1
1: 37
2: 308
3: 1660
4: 7204
Right 1156078195 18:33305791-33305813 TTGGCTTCTCCCCTAACAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 137
1156078182_1156078190 7 Left 1156078182 18:33305742-33305764 CCCTCCTCCTTCTTCTCCTCCTT 0: 1
1: 37
2: 308
3: 1660
4: 7204
Right 1156078190 18:33305772-33305794 CCCCACAGACAAAGTGGCCTTGG 0: 1
1: 0
2: 2
3: 14
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156078182 Original CRISPR AAGGAGGAGAAGAAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr