ID: 1156081615

View in Genome Browser
Species Human (GRCh38)
Location 18:33342540-33342562
Sequence TGCTGCTCAAAGTGTCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156081615 Original CRISPR TGCTGCTCAAAGTGTCAGCT TGG (reversed) Intronic
901697558 1:11020434-11020456 TGCTTCTCAAAGGCTCATCTTGG - Exonic
902341182 1:15784653-15784675 TGCTGCTGAGAGTGCCCGCTGGG + Intronic
903389245 1:22952896-22952918 TGCTACTCAAAGTGTGGTCTTGG - Intergenic
906076042 1:43052878-43052900 TGCTACTCAAAGTGTGGTCTTGG - Intergenic
906339951 1:44970916-44970938 TGCTGGCCAAAGTCACAGCTTGG + Intronic
906681597 1:47729840-47729862 TGCTTCACAGAGTGTCAGCTGGG - Intergenic
906815874 1:48877895-48877917 TGCTGGTGAATGTGTAAGCTAGG - Intronic
908712920 1:67038328-67038350 TGCTGCACAAATTGTCTGCCTGG - Intronic
910074554 1:83262095-83262117 TTCTTCTCAAAGCATCAGCTTGG - Intergenic
913412224 1:118564599-118564621 TGCAGCCCAAAGTGACAGATGGG - Intergenic
917459313 1:175215887-175215909 TGCTGCTCAAACTGTCCCCATGG + Intergenic
918430539 1:184455456-184455478 TGTTTCTCAAAGTGTAACCTAGG - Intronic
921222929 1:212986596-212986618 TGGTCCTCATAGTGTCATCTGGG + Intronic
922888648 1:229042471-229042493 TGTTCCTAAAAGTGTTAGCTGGG - Intergenic
924278629 1:242413176-242413198 GGCTGGTCAGAGTGTCAGCATGG - Intronic
1062932011 10:1359735-1359757 TGCTGCTCACAGCCTCAGCCTGG - Intronic
1063383164 10:5599216-5599238 TGGTTCTCAAAGTGTCACCGAGG + Intergenic
1067439656 10:46301456-46301478 TCCTGCTCAAGGTGCCAGCCTGG - Intronic
1067720991 10:48727638-48727660 TGCTGCTCAAAGTGTTACTTCGG + Exonic
1068005178 10:51384704-51384726 TGCTGCTGAGAGTGGAAGCTGGG - Intronic
1068585017 10:58788271-58788293 TGCTACTAAAAGTGTCATCCAGG - Intronic
1070518238 10:77227798-77227820 TCTTGCTTAAAGTGACAGCTGGG - Intronic
1070993841 10:80757437-80757459 TGGTTCTCAAAGTTTCGGCTGGG - Intergenic
1073997587 10:109333449-109333471 TACTGCACAAAGTGTCATCCAGG - Intergenic
1076042456 10:127262377-127262399 TTCTGCTGAATGTGTCAACTGGG - Intronic
1080191948 11:29561163-29561185 TGGTGATGAAAGTGTTAGCTTGG + Intergenic
1081576008 11:44318978-44319000 TGCTACTTAAAGTGCCAGGTGGG - Intergenic
1083612357 11:64010216-64010238 TGTTGCCCAGAGTGTTAGCTGGG + Intronic
1084051705 11:66604488-66604510 TTCTGCCCAAAATGTCAGGTTGG + Intronic
1089762772 11:120740488-120740510 TGATGCTCAGAGTCCCAGCTGGG - Intronic
1090127609 11:124104566-124104588 TGCTGCTTAATGTGTAACCTTGG + Intergenic
1091099505 11:132857915-132857937 TGCTGCTCTAAGTGTTACCCTGG + Intronic
1091316184 11:134615599-134615621 TGCACCTCAAAGTGTGAGCCTGG - Intergenic
1094839967 12:34338761-34338783 TGCTGCCCAAAGTGGCAGGGAGG + Intergenic
1094840577 12:34341122-34341144 TGCTGCTCAAAGCGGCAGGGAGG + Intergenic
1097307867 12:58089062-58089084 TGCTACTCAAAGTGTGACCCTGG - Intergenic
1099494830 12:83334397-83334419 TTATAATCAAAGTGTCAGCTGGG - Intergenic
1099682132 12:85843457-85843479 TGCTGCTCAAAGGGTAAGTGTGG - Intergenic
1101121906 12:101590500-101590522 TGCTGATCAAACTGTTGGCTAGG - Intronic
1101415051 12:104501583-104501605 GGGTGCTCAGAGTGTCGGCTTGG - Intronic
1101741075 12:107500517-107500539 TGCTGATACACGTGTCAGCTAGG - Intronic
1103483516 12:121266822-121266844 TGCTGGGCAAAATGTCAGCTTGG - Intronic
1106069952 13:26400689-26400711 TGCTGATTAAAGTGTCATTTAGG + Intronic
1107664274 13:42673000-42673022 TGTTCCTCAAAGTCTCAACTGGG + Intergenic
1110178715 13:72589496-72589518 TGATGCTTAAATTGTCATCTTGG - Intergenic
1110399184 13:75069790-75069812 TGTTGCTCTAAGTGACAGATGGG + Intergenic
1112062253 13:95752777-95752799 TGATTCTCAAAGTGTGACCTAGG - Intronic
1115830156 14:37328681-37328703 TGCTCCTCAAAGTGTGATCCAGG - Intronic
1117736019 14:58769377-58769399 TGCTGCTCAAAGTGTGGTCCAGG + Intergenic
1117999877 14:61513026-61513048 TGTTACTGTAAGTGTCAGCTTGG - Intronic
1118870571 14:69737657-69737679 TTCTCCTCCAAGTGACAGCTTGG + Intronic
1120071673 14:80110406-80110428 AGCTACTCAAAATGTTAGCTTGG + Intergenic
1121389269 14:93560405-93560427 TGCAGCTTAAAGAGTCAACTTGG + Intronic
1121585516 14:95060534-95060556 TGCTACTCAAAGTGTGGTCTAGG - Intergenic
1124509421 15:30310373-30310395 TGCTGTCCACTGTGTCAGCTAGG - Intergenic
1124734138 15:32228289-32228311 TGCTGTCCACTGTGTCAGCTAGG + Intergenic
1127337789 15:58006789-58006811 TGATGCACAAATTCTCAGCTGGG + Intronic
1130787058 15:87110811-87110833 TTCTTCTCTAAGTGGCAGCTTGG - Intergenic
1131145539 15:90009272-90009294 TGCTTCTCAAGGGGCCAGCTTGG - Intronic
1132471074 16:103471-103493 TGCAGCTCAAAGTGGCTGTTGGG + Intronic
1134157018 16:11851999-11852021 TGCTGCTTAACGTGGCAGGTCGG - Intergenic
1134818276 16:17224328-17224350 TGCTGCTAAAAGTGTTCGTTGGG - Intronic
1135198008 16:20410412-20410434 TGCTACTCAAAGTGTGATCTTGG - Intronic
1135760184 16:25131622-25131644 TGCTGCTCAAAGTATGTGCATGG - Intronic
1135993857 16:27233877-27233899 GGCTGCTCCAAGTGCCATCTGGG - Intronic
1136060797 16:27725004-27725026 TGATTCTGTAAGTGTCAGCTGGG + Intronic
1137945609 16:52731017-52731039 AGCTTGTCAAAGTGTCAGCCAGG - Intergenic
1140350548 16:74258136-74258158 TGCTGCTCAAGGCCTCAGCTTGG - Intergenic
1140437113 16:74956424-74956446 TGCTGTTAAATGTGTCATCTGGG - Intronic
1142888927 17:2930322-2930344 AGCTGCTCACTGTGCCAGCTGGG + Intronic
1143141651 17:4744713-4744735 TGCAGATCAAGGTGTCAGCAAGG + Exonic
1146180483 17:30694937-30694959 TGCTTCTCAAAGTGTTTGTTAGG + Intergenic
1152170263 17:78741652-78741674 TGCTGCTAAAAGTGGCAAATGGG + Intronic
1152224700 17:79087333-79087355 TGCTGCTCAAGGGGTCAGCCTGG - Intronic
1153018175 18:603134-603156 TGCTACTCAAAGTATGAGCCAGG + Intronic
1155682890 18:28511549-28511571 CTCTGCTGGAAGTGTCAGCTAGG - Intergenic
1156081615 18:33342540-33342562 TGCTGCTCAAAGTGTCAGCTTGG - Intronic
1161057264 19:2196929-2196951 TGCTGCTTCTAGTGTCAGCGCGG + Intronic
1162086535 19:8252905-8252927 ACCTGCTCACAGTGTCACCTTGG + Intronic
1162172824 19:8804784-8804806 TGATGCTCTGAGGGTCAGCTGGG + Intergenic
1166896071 19:46022611-46022633 AGCTGCTCAGGGTGTCAGCCAGG + Intronic
1166983454 19:46645765-46645787 TGCTGTTAGAAATGTCAGCTGGG + Intergenic
925685177 2:6463855-6463877 GCCTTCTCAAAGTCTCAGCTTGG - Intergenic
930088573 2:47515865-47515887 TCCTTCCCACAGTGTCAGCTGGG - Intronic
932322264 2:70831015-70831037 TGGAGCTCAAAGAGTGAGCTTGG + Exonic
933407355 2:81877649-81877671 TGCTGCTCATGGTGTATGCTAGG - Intergenic
938964457 2:136376023-136376045 TCCTGTTCAAAGTGCCCGCTGGG + Intergenic
940512908 2:154641753-154641775 TGCTGCTCCTTTTGTCAGCTGGG - Intergenic
942223877 2:173798051-173798073 TCCTATTCACAGTGTCAGCTGGG + Intergenic
946526728 2:220529028-220529050 AGCTATTCAATGTGTCAGCTCGG + Intergenic
948157303 2:235793631-235793653 TGCTGCTCAAAGGCTGAGCAGGG - Intronic
948477896 2:238232277-238232299 TGCTTCTCAAAGGCTCATCTTGG - Intergenic
949078243 2:242075076-242075098 TTCTGCTCCAAGTGCCAACTTGG + Intergenic
1169505106 20:6201626-6201648 TGCTTCTCAAAGGCTCATCTGGG + Intergenic
1172174344 20:32963105-32963127 TGGAGGTCAAGGTGTCAGCTTGG + Intergenic
1172886496 20:38234648-38234670 TGCTGCTCAAAGTGTGGTCTGGG - Intronic
1172965912 20:38835123-38835145 TGCTTCTCAAAGTGTGGTCTGGG - Intronic
1173149833 20:40557545-40557567 GGCTCCTCAAGGTGTCAGCAGGG + Intergenic
1173401296 20:42728353-42728375 TGCTACTCAAAGTGTGATCATGG - Intronic
1173862390 20:46292592-46292614 TGCAACTCAAAGTGGCATCTTGG + Intronic
1173924350 20:46769724-46769746 TGCTGCTCAGAGTGTGGCCTAGG + Intergenic
1174340666 20:49893107-49893129 TGCTGAGCAGAGTGTCAGCTGGG + Intergenic
1175334147 20:58184233-58184255 TGCTCCACACGGTGTCAGCTGGG + Intergenic
1176804153 21:13463857-13463879 TGCAGCTCTCTGTGTCAGCTGGG - Intergenic
1176982408 21:15398266-15398288 TGCTGATTCAAGTGGCAGCTTGG + Intergenic
1178994364 21:37384802-37384824 TGCTGCTAAAAGTTTGATCTGGG - Intronic
1179477828 21:41659318-41659340 TCCTGCTCCAGGTGTCAGCCAGG + Intergenic
1183017176 22:34998397-34998419 TGGATCTCAAAGTGTCACCTGGG + Intergenic
1183227332 22:36559362-36559384 TGCTCCTCAAAGTAGCAGCATGG - Intergenic
1185155782 22:49192625-49192647 TGGGGCTCAAAGTGTGAGCCAGG + Intergenic
949865298 3:8542301-8542323 TGCAGCTCAAAGCTCCAGCTGGG - Intronic
950560597 3:13719362-13719384 TCCCGGCCAAAGTGTCAGCTTGG - Intergenic
951511851 3:23511127-23511149 TCTTGCTCAAAATGTCAGCTGGG - Intronic
952662349 3:35866874-35866896 AGATGATCACAGTGTCAGCTGGG + Intergenic
952929786 3:38350150-38350172 AGGTGCACAAAGGGTCAGCTGGG - Intronic
953725646 3:45395483-45395505 TACTGGTCAAAATGACAGCTGGG + Intronic
956090756 3:65664143-65664165 TGCTGAACAAATTGTCACCTAGG + Intronic
956892832 3:73629096-73629118 TGCTGCTCAAAGTGTGGTCTGGG + Intergenic
959902016 3:111672206-111672228 TGCTACTCAAAGTGTAGTCTGGG + Intergenic
965189651 3:165511844-165511866 CTCTGCTCTAAGTGTAAGCTGGG - Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
969539204 4:7775695-7775717 TGCAGCTACAAGTGTAAGCTGGG - Intronic
970826060 4:20276951-20276973 TATTGCTCAAAGTGTTACCTAGG + Intronic
974644108 4:64670933-64670955 GGCAGCTCCAAGTGTCAGCATGG + Intergenic
975101802 4:70522141-70522163 TGCTGCTCACCATGTCACCTTGG + Intronic
976671261 4:87656767-87656789 TGCTTCTTAAAGTGTCATCCTGG + Intronic
982865277 4:160502296-160502318 TGCTACTCAAAGTGTGATCCAGG - Intergenic
985172982 4:187172348-187172370 TCCTGGTGAAAGTCTCAGCTGGG + Intergenic
985341765 4:188962016-188962038 TGGTGCTCAAAGTGTCTGTCTGG + Intergenic
986661586 5:10064747-10064769 TACTGCTCAAACTGTCCGCAGGG - Intergenic
986748352 5:10762864-10762886 GGCTGCTCACTCTGTCAGCTTGG + Intergenic
988371923 5:30381351-30381373 TTCTGCTCTAGGTGGCAGCTTGG + Intergenic
989006269 5:36816159-36816181 TGCTGCATATAGTGTTAGCTAGG - Intergenic
990726560 5:58762034-58762056 TGCTTCTAAAAGTGGCTGCTAGG - Intronic
990763264 5:59154022-59154044 TGCTGCTGAAAGAGTCAGCCAGG + Intronic
992661314 5:78963812-78963834 CCCTGCCCAAAGTGTCTGCTTGG - Intronic
994523478 5:100873079-100873101 TGCTACTCAAAGTGTGGTCTTGG - Intronic
996760418 5:126981014-126981036 TGCTGCACAAAGAATCAGCCTGG + Intronic
1001678097 5:173535222-173535244 TGATGCTCAAAGTGTGTGCATGG + Intergenic
1002371015 5:178754718-178754740 TGCTACTCAAAGTGTGGCCTGGG + Intergenic
1003622229 6:7710951-7710973 TTATGGTCAAAGTGCCAGCTTGG + Intergenic
1004536164 6:16504597-16504619 TGCTTCTCCAAGTGTGAGATTGG - Intronic
1008237752 6:49070551-49070573 TGCTGCTCAGATTTTCTGCTGGG + Intergenic
1010561597 6:77358024-77358046 TGGAGCTTAAAGTGTCATCTTGG - Intergenic
1011361897 6:86535473-86535495 CTGTGATCAAAGTGTCAGCTAGG - Intergenic
1011413380 6:87090204-87090226 TGGTTCTCAAAGTGTGATCTGGG + Intronic
1015202609 6:130600271-130600293 TGGTGGTCAAGATGTCAGCTGGG + Intergenic
1016067165 6:139696573-139696595 AGCAGCTCAAATTTTCAGCTTGG - Intergenic
1016128714 6:140438335-140438357 AGCTCTTCACAGTGTCAGCTGGG + Intergenic
1019217518 6:170453395-170453417 GGCTGCTCCAATTGGCAGCTGGG - Intergenic
1020208895 7:6142931-6142953 GGCTGCTCAGAGTGTCAACAAGG + Exonic
1022474041 7:30698908-30698930 TGCTGCTTAATGTGTGACCTTGG - Intronic
1022829064 7:34046442-34046464 TTCTTCTCAAAGTTTCTGCTGGG + Intronic
1023064416 7:36362745-36362767 TGCTGCTCCCTGTGTCTGCTGGG + Intronic
1023840107 7:44092223-44092245 TGCTCCACACGGTGTCAGCTGGG - Intergenic
1026322726 7:69281723-69281745 TGATGCACAAAGCATCAGCTAGG - Intergenic
1027292254 7:76726973-76726995 TTCTTCTCAAAGCATCAGCTTGG - Intergenic
1028332629 7:89614565-89614587 CTTTGCTCAAAGTATCAGCTAGG - Intergenic
1031009954 7:116515518-116515540 TGCTACTCAAAGTTTGATCTAGG - Intergenic
1032384043 7:131509246-131509268 TGCTGCTCAAAGCCCCAGCCAGG + Intronic
1033543555 7:142379641-142379663 TGGTGCTGAAAGTCACAGCTGGG - Intergenic
1034924067 7:155106906-155106928 TGCTGTTCACAGGGTCTGCTTGG - Intergenic
1036413143 8:8521031-8521053 TGATGCTAAAAGTCTCACCTTGG - Intergenic
1036501052 8:9314100-9314122 TGCTGCTAATTGTGTCATCTTGG + Intergenic
1037571876 8:20164868-20164890 TGCTCCCCCAAGTGGCAGCTGGG - Exonic
1038730558 8:30122989-30123011 TGCTCCACATGGTGTCAGCTGGG + Intronic
1041137468 8:54775610-54775632 TGCTCCACATAGTGTCAACTGGG - Intergenic
1041496799 8:58494560-58494582 TGCTGGTCAAAAAGTCAGCTTGG - Exonic
1045149461 8:99387520-99387542 TGCTGTTCAAAATGTAAACTGGG - Intronic
1045834883 8:106508058-106508080 TGCTTCTCCAAGTGCCAGCTTGG + Intronic
1046292289 8:112178854-112178876 TGCTGCCTAAAGTATCAGGTAGG - Intergenic
1047807031 8:128371517-128371539 AGCTGCTCACAGTGTCAGGCAGG + Intergenic
1049498012 8:142945787-142945809 TGCTGCTCAGAGGGGAAGCTGGG - Intergenic
1051860041 9:21614348-21614370 TCCTGGACAAAGTGTCATCTTGG + Intergenic
1053259061 9:36645807-36645829 TGCTGTTCAAAGTGTGGCCTAGG + Intronic
1053266017 9:36714208-36714230 TTCAGCGCAAAGTGCCAGCTGGG + Intergenic
1054121627 9:61214076-61214098 TTCTTCTCCAAGTGTTAGCTAGG + Intergenic
1054715691 9:68555989-68556011 TGCTACTCAAAGTGTGGTCTAGG - Intergenic
1056108715 9:83373252-83373274 TGCAGCTCAAAGAATCACCTAGG - Intronic
1056293062 9:85163361-85163383 TGCTTCTCACAGTTTCAGCAGGG + Intergenic
1056773243 9:89494991-89495013 TGCTGATCCAAGTGACAGCCTGG + Intronic
1057173380 9:92976908-92976930 CACTGCTCAAGGTGTCAGGTGGG - Intronic
1057231157 9:93322272-93322294 TGCTGCACAGCGTGCCAGCTGGG + Intronic
1058754856 9:108074936-108074958 TGCAGTTCAAAGTGTCTGCATGG + Intergenic
1059349597 9:113655065-113655087 TGCTTCTCAATGTGTGATCTTGG + Intergenic
1061684444 9:132263633-132263655 TGCTGCCCAAAGTGTCCCCTAGG + Exonic
1186515353 X:10162816-10162838 TGATCTTCAAAGTGTCATCTGGG - Intronic
1186746328 X:12573676-12573698 TGATTCTCAAAGTGTGATCTAGG + Intronic
1186815927 X:13238100-13238122 TGCTACTCAAAGTGTGATCTTGG + Intergenic
1188336834 X:28946376-28946398 TGCTGCTTAATTTGTCATCTAGG + Intronic
1189281702 X:39823689-39823711 TGCTTCACTCAGTGTCAGCTGGG - Intergenic
1189340518 X:40201355-40201377 TGCTCCACGTAGTGTCAGCTGGG + Intergenic
1189699681 X:43705064-43705086 TTCTGCAAAAACTGTCAGCTAGG - Intronic
1196019840 X:110979871-110979893 TTCTGTTTAAAGTGTCAGCTGGG + Intronic
1197150897 X:123218863-123218885 TGCTTTCCAAAGTGACAGCTGGG + Intronic