ID: 1156088762

View in Genome Browser
Species Human (GRCh38)
Location 18:33440601-33440623
Sequence GGGCGCTTGTGCCTCGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156088762_1156088769 9 Left 1156088762 18:33440601-33440623 CCCGCGCCGAGGCACAAGCGCCC 0: 2
1: 0
2: 0
3: 3
4: 64
Right 1156088769 18:33440633-33440655 CACAAGCGCCCCCGACTCACCGG 0: 1
1: 0
2: 0
3: 16
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156088762 Original CRISPR GGGCGCTTGTGCCTCGGCGC GGG (reversed) Intronic