ID: 1156088762 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:33440601-33440623 |
| Sequence | GGGCGCTTGTGCCTCGGCGC GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 69 | |||
| Summary | {0: 2, 1: 0, 2: 0, 3: 3, 4: 64} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1156088762_1156088769 | 9 | Left | 1156088762 | 18:33440601-33440623 | CCCGCGCCGAGGCACAAGCGCCC | 0: 2 1: 0 2: 0 3: 3 4: 64 |
||
| Right | 1156088769 | 18:33440633-33440655 | CACAAGCGCCCCCGACTCACCGG | 0: 1 1: 0 2: 0 3: 16 4: 51 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1156088762 | Original CRISPR | GGGCGCTTGTGCCTCGGCGC GGG (reversed) | Intronic | ||