ID: 1156088766

View in Genome Browser
Species Human (GRCh38)
Location 18:33440621-33440643
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156088766_1156088776 18 Left 1156088766 18:33440621-33440643 CCCGCGCCGAGGCACAAGCGCCC 0: 2
1: 0
2: 0
3: 3
4: 64
Right 1156088776 18:33440662-33440684 GCGTTTCCCCGCGCGTCTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156088766 Original CRISPR GGGCGCTTGTGCCTCGGCGC GGG (reversed) Intronic