ID: 1156088776

View in Genome Browser
Species Human (GRCh38)
Location 18:33440662-33440684
Sequence GCGTTTCCCCGCGCGTCTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 57}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156088766_1156088776 18 Left 1156088766 18:33440621-33440643 CCCGCGCCGAGGCACAAGCGCCC 0: 2
1: 0
2: 0
3: 3
4: 64
Right 1156088776 18:33440662-33440684 GCGTTTCCCCGCGCGTCTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 57
1156088770_1156088776 -2 Left 1156088770 18:33440641-33440663 CCCCCGACTCACCGGCTCCGCGC 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1156088776 18:33440662-33440684 GCGTTTCCCCGCGCGTCTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 57
1156088772_1156088776 -4 Left 1156088772 18:33440643-33440665 CCCGACTCACCGGCTCCGCGCGT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1156088776 18:33440662-33440684 GCGTTTCCCCGCGCGTCTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 57
1156088771_1156088776 -3 Left 1156088771 18:33440642-33440664 CCCCGACTCACCGGCTCCGCGCG 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1156088776 18:33440662-33440684 GCGTTTCCCCGCGCGTCTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 57
1156088773_1156088776 -5 Left 1156088773 18:33440644-33440666 CCGACTCACCGGCTCCGCGCGTT 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1156088776 18:33440662-33440684 GCGTTTCCCCGCGCGTCTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 57
1156088767_1156088776 17 Left 1156088767 18:33440622-33440644 CCGCGCCGAGGCACAAGCGCCCC 0: 1
1: 1
2: 0
3: 9
4: 89
Right 1156088776 18:33440662-33440684 GCGTTTCCCCGCGCGTCTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 57
1156088768_1156088776 12 Left 1156088768 18:33440627-33440649 CCGAGGCACAAGCGCCCCCGACT 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1156088776 18:33440662-33440684 GCGTTTCCCCGCGCGTCTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156088776 Original CRISPR GCGTTTCCCCGCGCGTCTCC CGG Exonic