ID: 1156088857

View in Genome Browser
Species Human (GRCh38)
Location 18:33440941-33440963
Sequence CCCTCTTTACCGGAGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156088844_1156088857 27 Left 1156088844 18:33440891-33440913 CCAGTGCCTTTCCCTTTCTCTTG 0: 1
1: 0
2: 4
3: 80
4: 906
Right 1156088857 18:33440941-33440963 CCCTCTTTACCGGAGAGGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 85
1156088848_1156088857 1 Left 1156088848 18:33440917-33440939 CCGATTTGCCAACCCAACTCCTT 0: 1
1: 0
2: 0
3: 21
4: 183
Right 1156088857 18:33440941-33440963 CCCTCTTTACCGGAGAGGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 85
1156088846_1156088857 16 Left 1156088846 18:33440902-33440924 CCCTTTCTCTTGTAACCGATTTG 0: 1
1: 0
2: 0
3: 10
4: 156
Right 1156088857 18:33440941-33440963 CCCTCTTTACCGGAGAGGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 85
1156088845_1156088857 21 Left 1156088845 18:33440897-33440919 CCTTTCCCTTTCTCTTGTAACCG 0: 1
1: 0
2: 2
3: 39
4: 447
Right 1156088857 18:33440941-33440963 CCCTCTTTACCGGAGAGGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 85
1156088847_1156088857 15 Left 1156088847 18:33440903-33440925 CCTTTCTCTTGTAACCGATTTGC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1156088857 18:33440941-33440963 CCCTCTTTACCGGAGAGGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 85
1156088849_1156088857 -7 Left 1156088849 18:33440925-33440947 CCAACCCAACTCCTTTCCCTCTT 0: 1
1: 1
2: 5
3: 75
4: 679
Right 1156088857 18:33440941-33440963 CCCTCTTTACCGGAGAGGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 85
1156088843_1156088857 28 Left 1156088843 18:33440890-33440912 CCCAGTGCCTTTCCCTTTCTCTT 0: 1
1: 0
2: 8
3: 108
4: 984
Right 1156088857 18:33440941-33440963 CCCTCTTTACCGGAGAGGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156088857 Original CRISPR CCCTCTTTACCGGAGAGGGA AGG Intronic
900105523 1:979322-979344 CCCTCGTCACGGCAGAGGGAGGG + Exonic
905851380 1:41277582-41277604 CACTCTGCACCTGAGAGGGAGGG + Intergenic
908451839 1:64263675-64263697 CCCTCTTTTGCAGAGAAGGATGG + Intronic
911245061 1:95507768-95507790 CCCACTTTACAGGAGTAGGAAGG - Intergenic
911449890 1:98049112-98049134 CCCTTTCTACTTGAGAGGGAAGG - Intergenic
912512643 1:110199287-110199309 GCCTCTTTCCTGGAGAGAGAAGG + Exonic
912756198 1:112326512-112326534 GGCTCTTTGCCGCAGAGGGAAGG - Intergenic
915224474 1:154402459-154402481 CCCCCTTTACAGGAGACGGAGGG + Intergenic
917691849 1:177477886-177477908 ACCTGTTTTTCGGAGAGGGAGGG + Intergenic
920099296 1:203507071-203507093 CCCTCTGCACCAGGGAGGGAAGG + Intronic
922202776 1:223420377-223420399 CCCTCTTTACAGGTCAGGGATGG - Intergenic
924280145 1:242428980-242429002 CCATCTTTAGAGGAGATGGACGG - Intronic
1073488004 10:103833945-103833967 CTCTCTTTCCGGGAGGGGGAGGG - Intronic
1089180740 11:116581312-116581334 CTCTCTTACCCGGAGGGGGACGG - Intergenic
1089486756 11:118852528-118852550 CTCTCTTGACCCAAGAGGGAAGG - Intergenic
1091223543 11:133944853-133944875 CCCTCTCTAGGGCAGAGGGAAGG + Intronic
1094402014 12:30071990-30072012 CCCTCTTTACCAGAAATGGGCGG + Intergenic
1098223598 12:68297645-68297667 CCCTCTTTCCCAAAGAGGCATGG + Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1108715532 13:53074688-53074710 CGCTCTTAACTGGAGCGGGAAGG + Intergenic
1108779585 13:53812901-53812923 GCTTCTTTTCAGGAGAGGGAGGG + Intergenic
1112103418 13:96215023-96215045 CCCATTTTACCAGAGTGGGAGGG + Intronic
1117579909 14:57142132-57142154 ACCTCTTTACCTGGGAGGGGTGG - Intergenic
1119562993 14:75605790-75605812 CCCTCTTTTCCGGAGCTGGCAGG - Intronic
1120668690 14:87338212-87338234 CCCTCTTTCCAGTACAGGGAGGG + Intergenic
1121869383 14:97393204-97393226 CCTTCTTCACCAGAGGGGGAAGG + Intergenic
1122080760 14:99265749-99265771 CCCTGTGTACTGGAGAGTGAAGG + Intronic
1122205396 14:100145657-100145679 CCCTCCCTGCCAGAGAGGGATGG - Exonic
1125634258 15:41174045-41174067 CCCTTGTTACCGGAAAGGGGGGG + Intergenic
1131144173 15:90000889-90000911 CCCTTTGTACCGGACAGGGCCGG + Intergenic
1132472543 16:113739-113761 TCCTGTTTATCTGAGAGGGAAGG + Intronic
1134513012 16:14863907-14863929 CCCTGTTTCCCACAGAGGGAGGG - Intronic
1134700650 16:16262396-16262418 CCCTGTTTCCCACAGAGGGAGGG - Intronic
1134971175 16:18532263-18532285 CCCTGTTTCCCACAGAGGGAGGG + Intronic
1136301731 16:29339332-29339354 CCCTCTTCACTGCAGTGGGATGG + Intergenic
1145357347 17:22171712-22171734 TCCTGTTTTCAGGAGAGGGAGGG - Intergenic
1147600264 17:41740839-41740861 CCCTGGGTACGGGAGAGGGAGGG - Intergenic
1156088857 18:33440941-33440963 CCCTCTTTACCGGAGAGGGAAGG + Intronic
1156290838 18:35747735-35747757 CCCTGTTTACCACAGAGGGAAGG - Intergenic
1159687288 18:71438333-71438355 CCCTCTCTCAGGGAGAGGGAAGG + Intergenic
1162794044 19:13077585-13077607 CCATCTTAACTGCAGAGGGAAGG - Intronic
1163737155 19:18988440-18988462 CCCACTGTCCCGGAGAGGCAGGG + Intergenic
1163806850 19:19405029-19405051 TCCTTGTTACTGGAGAGGGAGGG + Intronic
925012222 2:494886-494908 CCCTCTTTCTCAGAGAAGGAGGG + Intergenic
929557889 2:42936844-42936866 TCCTCTTTCCTGGAGAGGGATGG - Intergenic
929878132 2:45814046-45814068 CCCTCTGTGCGGGAGGGGGAGGG - Intronic
931431651 2:62213425-62213447 ACCTCCTTTCTGGAGAGGGATGG - Intronic
931553603 2:63474633-63474655 CCATCTGTATCTGAGAGGGATGG + Intronic
931839307 2:66131818-66131840 CACTCTTCACTGGAGATGGAGGG - Intergenic
932073368 2:68643098-68643120 GCCTCTTTTACGGAGAGGTAGGG + Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
935317332 2:101848652-101848674 CCCTTTTTGCAGGTGAGGGAGGG + Intronic
941640829 2:167986526-167986548 CTCTCTTTATCTAAGAGGGAAGG - Intronic
1176342750 21:5713771-5713793 CCCTGTTTACGGGATGGGGAGGG + Intergenic
1176475004 21:7145922-7145944 CCCTGTTTACGGGATGGGGAGGG + Intergenic
1176502077 21:7610685-7610707 CCCTGTTTACGGGATGGGGAGGG - Intergenic
1176537071 21:8111840-8111862 CCCTGTTTACGGGATGGGGAGGG + Intergenic
1178305647 21:31488120-31488142 CCCACTTCACAGCAGAGGGAGGG + Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1183781580 22:40002359-40002381 CCCTCTTTGGGGAAGAGGGAGGG + Intronic
1184716036 22:46282320-46282342 CCCTCTTTCCAGGGGAGGCAAGG + Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
956742303 3:72284854-72284876 CCCTCCTTATCAGGGAGGGAAGG - Intergenic
962634802 3:137319574-137319596 CCCCCTTTCCAGGAGAGTGAAGG + Intergenic
962879257 3:139560826-139560848 CCTTCTTTACAGGAGAGGAAAGG - Exonic
964480256 3:157132249-157132271 CCCTCTTTTCCTGAGAAGGCAGG + Intergenic
980914835 4:139024550-139024572 GCCTCTTTCCTGGAGAGGAAGGG + Intronic
985101347 4:186461540-186461562 CCCTCTCTACCGGGAAGGGCAGG - Intronic
986706019 5:10455499-10455521 GCCTCTTTCCCACAGAGGGAGGG - Intronic
993423349 5:87730270-87730292 CCCACTTTACAGTAGAAGGAGGG - Intergenic
995574609 5:113515954-113515976 CCTGCTTTACCAGAAAGGGAAGG - Intronic
997608362 5:135192605-135192627 CCCTCTATAGGGGAGAGAGAAGG - Intronic
997631596 5:135373002-135373024 CCCTCATTAACAGAGAGGAAGGG + Intronic
1005206274 6:23408869-23408891 TCCCCTTTACAGGAGAGGCAGGG - Intergenic
1006460775 6:34156533-34156555 CCCACTTTGCCTGAGAGGGTGGG - Intergenic
1010822709 6:80433649-80433671 CCCCCTTTCCAGGAGAGTGAAGG + Intergenic
1019477175 7:1249605-1249627 CCCTCATACCCCGAGAGGGAAGG - Intergenic
1019782146 7:2947541-2947563 ACCTCTTTGCGGGAGAGGGAGGG - Intronic
1028840560 7:95425377-95425399 CCCTCTAGAGTGGAGAGGGAGGG - Intronic
1029177005 7:98671761-98671783 CCTTCTTTTCCCAAGAGGGAGGG - Intergenic
1031381154 7:121087451-121087473 CCCTCTTTCTTAGAGAGGGAAGG + Intronic
1031867176 7:127050303-127050325 CCCTCATTTTCGGACAGGGAGGG + Intronic
1032122712 7:129168657-129168679 CCCTGCTTGCTGGAGAGGGAGGG - Exonic
1037285499 8:17294440-17294462 CCCCCTTTCCAGGAGAGTGAAGG + Intronic
1038433619 8:27519478-27519500 GGCTCTTTACTGGAGGGGGACGG - Intronic
1039979259 8:42392271-42392293 CCCTCCTTACGGCCGAGGGAGGG + Intronic
1050340393 9:4631901-4631923 CCCACTTTAATGGAGAGGGAAGG - Intronic
1051164698 9:14248867-14248889 CCCTCTTTGCCCGAGAAGTAAGG + Intronic
1189450012 X:41120278-41120300 CCCTCTTTACAGGTAAGGAAAGG - Intronic
1190475531 X:50823457-50823479 CCCTCTTTTGCAGAGAAGGAAGG + Intergenic