ID: 1156096617

View in Genome Browser
Species Human (GRCh38)
Location 18:33540554-33540576
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156096617_1156096621 30 Left 1156096617 18:33540554-33540576 CCTGCAGAGTGGAGCCCACAGGA No data
Right 1156096621 18:33540607-33540629 TGCCCTTCTCCTTAACTCACTGG No data
1156096617_1156096620 -7 Left 1156096617 18:33540554-33540576 CCTGCAGAGTGGAGCCCACAGGA No data
Right 1156096620 18:33540570-33540592 CACAGGAAAAGCAGCATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156096617 Original CRISPR TCCTGTGGGCTCCACTCTGC AGG (reversed) Intergenic
No off target data available for this crispr