ID: 1156096620

View in Genome Browser
Species Human (GRCh38)
Location 18:33540570-33540592
Sequence CACAGGAAAAGCAGCATGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156096613_1156096620 1 Left 1156096613 18:33540546-33540568 CCCTGCCACCTGCAGAGTGGAGC No data
Right 1156096620 18:33540570-33540592 CACAGGAAAAGCAGCATGTGTGG No data
1156096615_1156096620 -4 Left 1156096615 18:33540551-33540573 CCACCTGCAGAGTGGAGCCCACA No data
Right 1156096620 18:33540570-33540592 CACAGGAAAAGCAGCATGTGTGG No data
1156096611_1156096620 12 Left 1156096611 18:33540535-33540557 CCGTTTGGTTTCCCTGCCACCTG No data
Right 1156096620 18:33540570-33540592 CACAGGAAAAGCAGCATGTGTGG No data
1156096614_1156096620 0 Left 1156096614 18:33540547-33540569 CCTGCCACCTGCAGAGTGGAGCC No data
Right 1156096620 18:33540570-33540592 CACAGGAAAAGCAGCATGTGTGG No data
1156096617_1156096620 -7 Left 1156096617 18:33540554-33540576 CCTGCAGAGTGGAGCCCACAGGA No data
Right 1156096620 18:33540570-33540592 CACAGGAAAAGCAGCATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156096620 Original CRISPR CACAGGAAAAGCAGCATGTG TGG Intergenic