ID: 1156096895

View in Genome Browser
Species Human (GRCh38)
Location 18:33544377-33544399
Sequence CTTCCATGATTGAGTACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156096895_1156096896 -8 Left 1156096895 18:33544377-33544399 CCAGAAGTACTCAATCATGGAAG No data
Right 1156096896 18:33544392-33544414 CATGGAAGTTAACAGCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156096895 Original CRISPR CTTCCATGATTGAGTACTTC TGG (reversed) Intergenic
No off target data available for this crispr