ID: 1156105390

View in Genome Browser
Species Human (GRCh38)
Location 18:33653296-33653318
Sequence CTAAGAATCTTGCAGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156105382_1156105390 -2 Left 1156105382 18:33653275-33653297 CCAACTACCTGGCAGCCATTCCT 0: 1
1: 0
2: 0
3: 23
4: 254
Right 1156105390 18:33653296-33653318 CTAAGAATCTTGCAGGGGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 159
1156105383_1156105390 -9 Left 1156105383 18:33653282-33653304 CCTGGCAGCCATTCCTAAGAATC 0: 1
1: 0
2: 0
3: 3
4: 126
Right 1156105390 18:33653296-33653318 CTAAGAATCTTGCAGGGGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156105390 Original CRISPR CTAAGAATCTTGCAGGGGGC AGG Intronic
901020485 1:6252760-6252782 CGTAGAGTCCTGCAGGGGGCAGG + Intronic
902135003 1:14297553-14297575 TAAAGGATCTTGCAGGGGGCAGG - Intergenic
903513450 1:23893825-23893847 TTAAGAAACTTTCTGGGGGCTGG + Intronic
904768756 1:32869809-32869831 CTCAGTATCTTCCAAGGGGCAGG + Intronic
904836666 1:33342133-33342155 CTGAGTTCCTTGCAGGGGGCTGG + Intronic
907404786 1:54247258-54247280 CCAAGCATCTTGCAGGAGGCAGG + Intronic
907750963 1:57262779-57262801 CTCAGAATCTGGCTGGGAGCAGG - Intronic
909762882 1:79314795-79314817 TTAAGAATATTGCAGGTGGATGG + Intergenic
915196084 1:154190832-154190854 CTAAGAATGTGGCATGGGGGAGG + Intronic
916729584 1:167553844-167553866 CTAAGCACAATGCAGGGGGCGGG + Intergenic
917106331 1:171496159-171496181 CTAAAAATCGTAAAGGGGGCAGG - Intronic
920194903 1:204220360-204220382 GAAAGCATCTTGCCGGGGGCAGG - Exonic
923467137 1:234259187-234259209 ATAAGAATCTTCCAGGGAGAAGG - Intronic
924008231 1:239635809-239635831 CTAAGCCTCTTGCAGGGGGCAGG - Intronic
1063529089 10:6813068-6813090 CTAAGAAACTTCCAGGGCTCTGG + Intergenic
1070790610 10:79187142-79187164 TTAACACTCTTGCAGGAGGCTGG - Intronic
1070856339 10:79610670-79610692 CTAAGGAGCTTGCTAGGGGCAGG + Intergenic
1071534836 10:86419901-86419923 GTAAAAATATTGAAGGGGGCTGG + Intergenic
1072257602 10:93635222-93635244 CTAAAAATTAGGCAGGGGGCTGG - Intronic
1073141807 10:101253327-101253349 CTAAGAAGCATGAAGGGGACAGG + Intergenic
1073321659 10:102619627-102619649 CTGAGAATCCGGCTGGGGGCAGG - Intronic
1073482810 10:103797704-103797726 CTTAGAATCTGGGAGGGGGTGGG + Intronic
1075275756 10:121091012-121091034 TTAAGAATGTTTCATGGGGCTGG + Intergenic
1077817045 11:5696144-5696166 CTGAGAATGTTGAAGGGGACAGG - Intronic
1079079033 11:17401295-17401317 CAAAGAAGCTTGCTGGGGACTGG - Intronic
1081554737 11:44148037-44148059 CTAAGAATCTTGAAAAGGACAGG - Intronic
1081733422 11:45387278-45387300 CCCAGAATCTTGCAGGAGGAAGG + Intergenic
1084034060 11:66497325-66497347 CTGAGAGTCTTGCTGGAGGCTGG + Exonic
1084667342 11:70583505-70583527 CTCTGATTCTTGCAAGGGGCTGG + Intronic
1084829759 11:71759889-71759911 CTAAGTTTGTTGCAGGGGTCGGG - Intergenic
1087239519 11:95759100-95759122 GTAAGAATCTAGCAAGAGGCCGG - Intergenic
1088005767 11:104938069-104938091 CTAAGAATATTGCATGATGCTGG - Intergenic
1088747409 11:112815728-112815750 ATAAGAATATGGCAGGGGGTGGG + Intergenic
1089166889 11:116484216-116484238 GTAAGAATCTCCCAGGGAGCAGG - Intergenic
1089345732 11:117790293-117790315 CTAAGAACCTTGGAGGGGAATGG + Intronic
1090204271 11:124876148-124876170 CTGAGGATCTTGACGGGGGCGGG + Intronic
1092132695 12:6123728-6123750 CTAAGCATCTTGCCAGGTGCTGG - Intronic
1094108046 12:26833523-26833545 CGAAGAAGCTTGATGGGGGCAGG + Intergenic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1099817539 12:87668410-87668432 CAAAGGCTCTTGCAGGGGCCTGG + Intergenic
1100292359 12:93229863-93229885 CACAGAGTGTTGCAGGGGGCGGG + Intergenic
1101022920 12:100572255-100572277 CTAAGAGTCTTGAAGGGTGATGG - Intergenic
1102215618 12:111159444-111159466 CTAAAATCCTTGCAGGTGGCTGG - Intronic
1104270662 12:127279922-127279944 CTAACAGTCATGCAGGGGCCCGG + Intergenic
1105519919 13:21122749-21122771 ATAGGAATCTGGCAGGGGGCAGG - Intergenic
1112022349 13:95382532-95382554 TTAAGAATCATTCAGAGGGCAGG - Intergenic
1112617877 13:101023993-101024015 CTAAGATTCTTTCAGAGGGCAGG + Intergenic
1115991171 14:39152164-39152186 CTTAGAATCCTGCAGGCAGCAGG - Intronic
1116262059 14:42643064-42643086 GTAAGAATCCTGCAAGGGCCCGG - Intergenic
1116622940 14:47228892-47228914 CCAAGATTTTTGCTGGGGGCTGG + Intronic
1118328827 14:64800357-64800379 CTAAGGATCTAGCAGAGGGAAGG + Intronic
1119969998 14:78959509-78959531 CTAAGAAACTTACAGGAGGTAGG + Intronic
1121779576 14:96613756-96613778 CCAAGCACCCTGCAGGGGGCTGG - Intergenic
1122219739 14:100229722-100229744 CTCAGAATAGTGCAGGGGGGAGG + Intergenic
1124129043 15:26968604-26968626 TTAAGAATCTTCAAAGGGGCCGG - Intergenic
1124259680 15:28177502-28177524 CTGTGAATGTTGCAGGTGGCCGG - Exonic
1126025003 15:44437966-44437988 CTAAGAATGTGGCAGCTGGCTGG + Intronic
1129029657 15:72609107-72609129 CAAGGAATATTGCAGGTGGCTGG - Intergenic
1133780586 16:8936038-8936060 CCAAAAAGCTGGCAGGGGGCGGG + Intronic
1134061708 16:11203165-11203187 CTGAGTCCCTTGCAGGGGGCAGG - Intergenic
1134503982 16:14790736-14790758 CTCAGCATCTGGCAGGGGCCTGG - Intronic
1134576590 16:15338172-15338194 CTCAGCATCTGGCAGGGGCCTGG + Intergenic
1134725849 16:16418327-16418349 CTCAGCATCTGGCAGGGGCCTGG - Intergenic
1134941584 16:18293532-18293554 CTCAGCATCTGGCAGGGGCCTGG + Intergenic
1138084561 16:54121971-54121993 CTAAGAATCCTGGAGTGAGCTGG + Intergenic
1138144808 16:54598978-54599000 ATATGAATCAGGCAGGGGGCTGG - Intergenic
1142048037 16:87938315-87938337 CTTACAATCTTTTAGGGGGCAGG + Intergenic
1143456596 17:7071822-7071844 CTAGGAATGTGGCTGGGGGCTGG + Intergenic
1143801174 17:9382572-9382594 TTAAAAATCTTGCTGGGGGAGGG - Intronic
1147212802 17:38881819-38881841 GCTAGGATCTTGCAGGGGGCTGG + Intronic
1147770787 17:42866631-42866653 CAAAGCATCTAGCAGGGAGCTGG - Intergenic
1148874833 17:50680776-50680798 CTTAAAACCTTGCAGGAGGCGGG + Intronic
1150687061 17:67329433-67329455 TTAAGAATCTTGAAGTTGGCCGG - Intergenic
1152368277 17:79869985-79870007 CTAAGAACCTTGCTGAGGCCAGG - Intergenic
1153791995 18:8586964-8586986 TTTAGAATATTGCAGGGGACTGG + Intergenic
1156105390 18:33653296-33653318 CTAAGAATCTTGCAGGGGGCAGG + Intronic
1159010874 18:63057789-63057811 CTAAGAAGCTTGCAGAGTCCTGG - Intergenic
1161279329 19:3436769-3436791 CTAAAAATCCTACAGGTGGCCGG - Intronic
1161759380 19:6160093-6160115 ATAAAAATCTCGCAGGGGCCGGG + Intronic
1162393315 19:10402749-10402771 CTAAGGATCCTGAAGGGGGACGG + Intronic
1162959994 19:14119937-14119959 CTAAGAATCTTCCTGGGAGCAGG + Exonic
1162992682 19:14313565-14313587 ATAAGAATTCTGGAGGGGGCCGG + Intergenic
1168017924 19:53588224-53588246 GTAAAAATCCTGGAGGGGGCTGG - Intergenic
1168064387 19:53910659-53910681 GGAAAAATCTTGCAGGGGTCGGG + Intronic
925441575 2:3891523-3891545 CTAAGAATAATACAGTGGGCTGG - Intergenic
929508552 2:42548166-42548188 CTAAAAATATTAAAGGGGGCCGG + Intronic
931183765 2:59929844-59929866 CTGAGGATCTGGCAGGGGGGTGG + Intergenic
931980043 2:67685103-67685125 CTAAGAGTCTGGCAGGGCCCCGG - Intergenic
931999736 2:67873670-67873692 TTGAGAAGCTTGCAGAGGGCTGG - Intergenic
932109748 2:68987191-68987213 TTTAGAATCTTGCAGAGGGCAGG - Intergenic
932375866 2:71235461-71235483 TTAAAAATCTGGCTGGGGGCTGG + Intergenic
933210095 2:79556527-79556549 CTAAGAATGTATCAGGGGACTGG - Intronic
933311546 2:80667461-80667483 CTAAGAATCATGCAATTGGCTGG - Intergenic
941956520 2:171211097-171211119 CTAAGAATGTAACATGGGGCAGG - Intronic
945587736 2:211687626-211687648 CAAAGAATCTGGAAAGGGGCAGG - Intronic
946796582 2:223360613-223360635 CTAAGAATCATGGACGGGACTGG + Intergenic
947758850 2:232588653-232588675 GTGAGGATGTTGCAGGGGGCAGG - Intergenic
948189327 2:236045913-236045935 CCCAAAATGTTGCAGGGGGCGGG - Intronic
1169431799 20:5542811-5542833 TTAAGAATATAGCAGGGGCCGGG - Intergenic
1172393604 20:34583413-34583435 AAACAAATCTTGCAGGGGGCAGG + Intronic
1173807189 20:45933900-45933922 AAAAGAATCCTGCAGGGAGCCGG + Intergenic
1175709715 20:61209602-61209624 CTAACAATCATTCAGAGGGCAGG + Intergenic
1178131956 21:29583486-29583508 GTCAGAATATTGAAGGGGGCTGG - Intronic
1179000321 21:37451820-37451842 CTCAGAATCTTACAGGGAACTGG - Intronic
1179442973 21:41408534-41408556 CTCATAATCTTGTAGGGGGAAGG - Exonic
1180790772 22:18574345-18574367 TTAAGTAGCTTGCTGGGGGCTGG - Intergenic
1181230965 22:21420969-21420991 TTAAGTAGCTTGCTGGGGGCTGG + Intronic
1181247683 22:21513900-21513922 TTAAGTAGCTTGCTGGGGGCTGG - Intergenic
1181989949 22:26829740-26829762 CTCAGCATCTTGCAGGGAGCTGG - Intergenic
1182456478 22:30454157-30454179 TTCAGCATCTTGCAGGAGGCTGG - Intronic
1182805968 22:33070656-33070678 CTAAGTACTGTGCAGGGGGCGGG + Intergenic
1183046148 22:35221851-35221873 TTAAGAATGGTGCAGGAGGCCGG - Intergenic
1185376765 22:50486255-50486277 ATGAGGATCTTGCAGGAGGCCGG - Exonic
950465054 3:13148721-13148743 CTCAGAAGCCTGCAGGGGCCAGG - Intergenic
953123725 3:40071227-40071249 CTAAGAATCTTGCTGGAGTTGGG + Intronic
955005767 3:54966946-54966968 CTCAGCATCTTGCTGGAGGCAGG + Intronic
955356031 3:58233771-58233793 CTAAGAGTCTGGCAGGTGACTGG + Intergenic
959258072 3:104039985-104040007 CAAAGTATCTTGGAGGAGGCTGG + Intergenic
961057857 3:123804231-123804253 ACAGAAATCTTGCAGGGGGCAGG + Intronic
961529119 3:127529112-127529134 CTCAGAATCTTGAAGGAGGCTGG + Intergenic
966914750 3:184578501-184578523 CTGAGAGCCCTGCAGGGGGCTGG - Intronic
967881679 3:194306100-194306122 CCAAGCATCTTGAAGGGTGCCGG - Intergenic
969870454 4:10101311-10101333 CTAAAGATCCTGCAGAGGGCTGG + Intronic
970262622 4:14244227-14244249 CTCAGAATCATGGTGGGGGCGGG - Intergenic
970741389 4:19241965-19241987 TTAAGAGTCTGGAAGGGGGCGGG + Intergenic
971499549 4:27303661-27303683 TTAAGAATCTTGAAGTGGGGAGG + Intergenic
971599351 4:28572417-28572439 CTTAGATTCTTCCAGGGAGCAGG - Intergenic
974997006 4:69173973-69173995 CTAAAAATCTTGCTGGATGCAGG - Intronic
975008045 4:69314814-69314836 CTAATAATCTTGCTGGATGCAGG + Intronic
975784664 4:77875360-77875382 GATAGAATTTTGCAGGGGGCTGG + Intronic
977592627 4:98843121-98843143 CTCAGAATCATGGTGGGGGCGGG - Intergenic
980282155 4:130736489-130736511 CTATGGATCTGGCAGGGGTCAGG + Intergenic
981828319 4:148970790-148970812 CTAAGATTCTTGAGGGGGCCAGG - Intergenic
990014325 5:51040441-51040463 CTAAAAATATTGCTGGAGGCAGG + Intergenic
990960046 5:61384759-61384781 GTAAAAATCTTGGAGGAGGCCGG + Intronic
994728311 5:103462407-103462429 CTAAGATTCTTGCAAGAGGCTGG - Intergenic
998032319 5:138881452-138881474 CTAAAAAGCTTGCTGTGGGCTGG - Intronic
1001209882 5:169800812-169800834 CTCAGAATCTTGGAGGGAGAGGG + Intronic
1001479661 5:172079307-172079329 CTAAGAACCTTCCAGGAGGGTGG - Intronic
1003748867 6:9033260-9033282 CTAAGAATCCTACAGTGGCCGGG - Intergenic
1005763149 6:28986195-28986217 CTGAGAATCCTGAAGGGGTCAGG - Intergenic
1006624720 6:35389235-35389257 CAAAGAACCTTGTAGGGTGCTGG + Intronic
1007353392 6:41292004-41292026 CTAAGAATCTTCCTGGGAGAAGG + Intergenic
1007701701 6:43769844-43769866 CTAGGAATATTGAAGGGGGCAGG - Intergenic
1012263142 6:97111243-97111265 CTATGCCTCTTGCAGGGGACAGG - Intronic
1012905952 6:105065866-105065888 GTAATAATAATGCAGGGGGCTGG + Intronic
1015767217 6:136731416-136731438 CTTAGAATCTTGAAGGGGCAAGG - Intronic
1016812169 6:148271917-148271939 CTGAGAGTTTTGTAGGGGGCGGG + Intergenic
1017970222 6:159305974-159305996 TTAAGTATCTCACAGGGGGCTGG + Intergenic
1020861571 7:13498839-13498861 TTTAGAGTCTTGCAGGAGGCTGG - Intergenic
1022676433 7:32503976-32503998 TTAAGAATCTTGCAAAGGCCAGG - Intronic
1023656161 7:42423022-42423044 CTAACAATCATGAAGGGGCCAGG - Intergenic
1025974238 7:66356912-66356934 CTCGGGCTCTTGCAGGGGGCTGG + Intronic
1029671590 7:102036249-102036271 TTAAGATTCTTGCTGGGGCCGGG - Intronic
1033332687 7:140429320-140429342 CTAAGAGTGGAGCAGGGGGCTGG - Intergenic
1033602469 7:142898095-142898117 TTAAGAATCATGAAGGAGGCTGG + Intergenic
1034680447 7:152924443-152924465 CTCAGCATCTTGCAGGTGCCAGG + Intergenic
1037203950 8:16291521-16291543 CTATGAGTCTTGCAGCTGGCAGG + Intronic
1037667005 8:20978479-20978501 CTAAGAATCATCCAGGAGGCTGG - Intergenic
1047737841 8:127782018-127782040 ATAAGAATCTTTCAGGTGGAAGG - Intergenic
1050070569 9:1808776-1808798 TGAAGAATGTTGCTGGGGGCTGG + Intergenic
1050823204 9:9909356-9909378 CTAACAAGATTGCTGGGGGCAGG + Intronic
1055452863 9:76446390-76446412 CTAAGAAGATTGCATGGAGCGGG - Intronic
1055635372 9:78272320-78272342 CTAAACATCTTTCATGGGGCTGG - Intronic
1058701544 9:107604794-107604816 TTAAAAATCTTGAAGTGGGCCGG - Intergenic
1059502407 9:114766505-114766527 CTAAGACTCTGACAGGGGACAGG + Intergenic
1059668503 9:116472010-116472032 ATTAGAACCATGCAGGGGGCTGG - Intronic
1061724133 9:132572294-132572316 CTAAGATTGAAGCAGGGGGCAGG + Intronic
1185730460 X:2457280-2457302 CTAAGAATGTGGCAGCGGGATGG + Intronic
1185761770 X:2693928-2693950 CTCAGAATCTTTCAAGGGCCAGG + Intronic
1195722351 X:107878765-107878787 CTATGCCACTTGCAGGGGGCAGG - Intronic
1197721711 X:129749633-129749655 TTGAATATCTTGCAGGGGGCAGG + Intronic
1198193389 X:134333935-134333957 GTAAGAATATGGCTGGGGGCAGG + Intergenic
1199207238 X:145163427-145163449 CTGAGAATTTTGCAGGGGACCGG - Intergenic