ID: 1156107012

View in Genome Browser
Species Human (GRCh38)
Location 18:33675536-33675558
Sequence CCCTGAACTCTGGTTTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156107012_1156107015 22 Left 1156107012 18:33675536-33675558 CCAGTGAAAACCAGAGTTCAGGG 0: 1
1: 0
2: 1
3: 26
4: 195
Right 1156107015 18:33675581-33675603 CATTGTGATATTTTCCTAAAAGG 0: 1
1: 0
2: 2
3: 44
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156107012 Original CRISPR CCCTGAACTCTGGTTTTCAC TGG (reversed) Intronic
900290901 1:1923214-1923236 TCCTGAACTCTGGTTAGCAGTGG + Intronic
900432345 1:2608256-2608278 CCCTGAACCCTGGTGCTCAGCGG + Intronic
900469086 1:2843093-2843115 CCCTGAGCTCTGGTTCCCACAGG + Intergenic
901259265 1:7859635-7859657 CACTGATCTCTGGTTTTATCTGG - Intergenic
902860924 1:19245030-19245052 CCCTGTACTCTTTTTTTCTCAGG - Exonic
904803853 1:33117444-33117466 CTCTGCACTTTGGTCTTCACTGG - Intronic
904847743 1:33432914-33432936 CCCAAAACTCTGGGATTCACAGG + Intergenic
905004597 1:34699532-34699554 CTCTGCACTCTGGTCTCCACTGG - Intergenic
905637023 1:39560764-39560786 CTATGAATTCCGGTTTTCACTGG - Intergenic
908069865 1:60448316-60448338 CCCAGAACATTGGTTGTCACTGG + Intergenic
912261810 1:108118364-108118386 TCCTGAACTCTGTATTTCAGAGG - Intergenic
912459981 1:109824052-109824074 TGCTGAACTCTGGTCTCCACAGG + Intergenic
914901515 1:151713706-151713728 CCCTTAACTCTGGCTGTGACAGG + Intronic
915631197 1:157155112-157155134 CCCTGAACTTTGGTCTTGTCAGG - Intergenic
916303423 1:163301685-163301707 CCCTTCACTCTGGCTTTCACAGG + Intronic
917959842 1:180133380-180133402 CCCTGACTCCTGCTTTTCACTGG - Intergenic
919831704 1:201545762-201545784 CCCAGTTCTCTGGTTTTCAGGGG - Intergenic
923005772 1:230048442-230048464 CCCTTTACTGTGGTTTCCACAGG - Intergenic
924404595 1:243730014-243730036 CCCTGAAGGTTGGGTTTCACTGG - Intronic
924818363 1:247463097-247463119 CCCTGGAGTCTGGCTTTCCCTGG + Intergenic
1063224023 10:3997777-3997799 CCCTGAAACCTGCTTTTGACAGG + Intergenic
1063493737 10:6488300-6488322 CCCTCACCTGTAGTTTTCACTGG + Intronic
1068919619 10:62469072-62469094 CCATGAACTCTGCTCTTGACTGG - Intronic
1069725111 10:70572459-70572481 CCCTGGGCTCTGGTTTTAAAAGG + Intergenic
1071090283 10:81910369-81910391 CCCAGAACTCTAGTCTTCAAGGG - Intronic
1071377968 10:85029962-85029984 ACCTGAAGTCTGATTTTCAAGGG - Intergenic
1071511799 10:86266764-86266786 CCCTGAACCCTGGGATTCACAGG + Intronic
1080684720 11:34505510-34505532 CCCTGAACTCTGGTGTTCCTAGG + Intronic
1083776159 11:64895209-64895231 CCCTGACCTCTGGCTTCCACAGG - Exonic
1084775492 11:71372133-71372155 CCCAGAGCTCTGGCCTTCACTGG + Intergenic
1085508047 11:77071281-77071303 CCCTGAACTCTGGCTACCAGGGG - Intronic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1088686320 11:112287163-112287185 CCCTGAGCTCTGGATGGCACTGG - Intergenic
1089303947 11:117515277-117515299 CCCTGTAGCCTGGTTTTCACAGG + Intronic
1090700299 11:129288814-129288836 TCCTGGGCTCTGCTTTTCACAGG - Intergenic
1091005976 11:131954165-131954187 CACTGGCCTCTGGTTTTCAGAGG - Intronic
1091440454 12:508679-508701 CTCTGACCTCTGATTTGCACAGG + Intronic
1093041175 12:14381081-14381103 CCCTTCACTCTGGTTTTCAAAGG + Intronic
1093403103 12:18770943-18770965 CCCTGCACTCTGTTTTGGACTGG - Intergenic
1093767571 12:22982479-22982501 CCCTGAAGTCTGGTCATCTCCGG - Intergenic
1093871387 12:24295861-24295883 CCTTGAATACTGTTTTTCACAGG + Intergenic
1093987259 12:25549631-25549653 CCCAGAATTCTGCTTTTCAAAGG + Intronic
1100176384 12:92035598-92035620 CTCAAAACTCTGCTTTTCACAGG - Intronic
1100612656 12:96204278-96204300 CCCTGAACTGTGGATCTTACAGG - Intronic
1103437260 12:120936535-120936557 CCCTGAACCCTGATTTTCCCTGG - Intergenic
1104303541 12:127588540-127588562 CCCTGAAATTTGGCTTTGACTGG + Intergenic
1105533526 13:21242713-21242735 CCCTGCACTCTGATTGACACAGG + Intergenic
1105946002 13:25190220-25190242 CCCTGAATTTTTATTTTCACTGG + Intergenic
1107022310 13:35764509-35764531 CCCTGGACTCTGGTTTTAGGAGG + Intergenic
1108408827 13:50127987-50128009 CCGAGAACTCTGGTTTTTGCGGG - Intronic
1111793976 13:92894415-92894437 CCCTGCCCTCTGTTTCTCACAGG + Intergenic
1113389756 13:109884031-109884053 CCCTAACCTCTGCATTTCACTGG + Intergenic
1113508472 13:110832628-110832650 TCCAGAACCCTGGTTTTCACGGG - Intergenic
1113706865 13:112440697-112440719 CTCTGAACTGTGGTTCTCAGAGG - Intergenic
1114853643 14:26411687-26411709 ACCTAGACTCTGTTTTTCACAGG - Intergenic
1119430042 14:74560922-74560944 CCATGAATTTTGGTATTCACAGG + Intronic
1119687373 14:76643553-76643575 CCCTGAACTCTGTGTTGCAGTGG - Intergenic
1120965446 14:90163607-90163629 ACTTGAACTGTGGTTTGCACTGG + Intronic
1121950739 14:98168800-98168822 GACTGAACTCTGGTTGTCTCTGG - Intergenic
1122131102 14:99604784-99604806 CCCTGAACTCTGGTGCCCCCGGG - Intergenic
1122315241 14:100822318-100822340 CCCAGAACTCTGGTTTTAAGGGG + Intergenic
1123025748 14:105422919-105422941 CCCTGACCTCTGCTTCTCAAGGG + Intronic
1123475379 15:20588167-20588189 CACTGAACTATGGTGTTCGCAGG - Intergenic
1124382522 15:29178510-29178532 CCCTGAATTCTGCTTGTCCCTGG + Intronic
1126019034 15:44381520-44381542 CCTTAAACTGTGCTTTTCACTGG + Intronic
1126368780 15:47923599-47923621 ATCTGAAATGTGGTTTTCACAGG + Intergenic
1126628229 15:50706827-50706849 CACTGAAATCTAGTTTTCATTGG - Exonic
1127095529 15:55508734-55508756 ACCTGAACTCAGCTTTTCATGGG - Intergenic
1128209543 15:65885798-65885820 CACTGTACACTGGTTTTCTCTGG + Intronic
1128621463 15:69154211-69154233 CCCTAAACTCTGGTTTGACCAGG + Intergenic
1129027202 15:72588200-72588222 ACATGAAGTCTGGATTTCACAGG - Exonic
1130685965 15:86037922-86037944 GCTTGAACTCTGGATTTCAATGG + Intergenic
1130925826 15:88385011-88385033 CCCTAACCTCTGGGTTTCAATGG + Intergenic
1133272774 16:4618762-4618784 CCCTGCACTCTGCATTTTACAGG - Intronic
1133544412 16:6791402-6791424 CCCTGAACTTTCATTTTCACAGG - Intronic
1134757341 16:16679645-16679667 TCCTGAACTCTGTGTGTCACAGG + Intergenic
1134988729 16:18679521-18679543 TCCTGAACTCTGTGTGTCACAGG - Intergenic
1137717041 16:50604334-50604356 CCCAGAACACTTGTTTTCAGAGG - Intronic
1138952320 16:61928310-61928332 CCTTTAACTTTGGTTTTGACAGG - Intronic
1139323852 16:66136336-66136358 CCCTGATCTCTTGATTTCATAGG - Intergenic
1140940507 16:79717620-79717642 CTCTGTCCTCTGATTTTCACAGG + Intergenic
1142236843 16:88926439-88926461 CCCTGTGCTGTGGTTTTCAGGGG + Intronic
1143365681 17:6406903-6406925 GCCTGAACTCCGGTTTTCCTTGG - Intronic
1144858928 17:18287630-18287652 CCATGAACCCTGGGTTTCAAGGG - Intronic
1145895798 17:28456765-28456787 GCCTGAACTCTGGCTGTCCCAGG + Intronic
1146883515 17:36456522-36456544 CCTTGGGCTCTGGTCTTCACTGG - Intergenic
1147855221 17:43474748-43474770 CCCTAAACTCTGGTTGTATCAGG + Intergenic
1151806041 17:76406044-76406066 CCCTGAAGCCTGGCTATCACCGG + Intronic
1154021581 18:10668232-10668254 CCCTCCGCTGTGGTTTTCACTGG - Intronic
1155174589 18:23291273-23291295 CCTTGAACTCTGTTCTTCTCAGG - Intronic
1156107012 18:33675536-33675558 CCCTGAACTCTGGTTTTCACTGG - Intronic
1158934084 18:62348776-62348798 CCGTGGACTGTGGCTTTCACTGG - Intronic
1165707700 19:37988148-37988170 CCGTGACCTCAGGTGTTCACAGG - Intronic
1167416474 19:49375794-49375816 CCCTCAGCTCTGGGTTTCACAGG + Intergenic
925186996 2:1854858-1854880 GCCTGAACTGTGGCGTTCACAGG - Intronic
925529018 2:4838965-4838987 CCCTGTTCTCTAGTCTTCACAGG - Intergenic
927678713 2:25125647-25125669 GCCTTAACTTTGGTTTTAACTGG - Intronic
928505525 2:31948579-31948601 CCTGGATCTCTGATTTTCACAGG + Intronic
929348289 2:40914899-40914921 CCCTGGACTCTGACTTTCTCAGG - Intergenic
930068031 2:47342728-47342750 CCCTCACCTTTGGTCTTCACTGG + Intergenic
935375300 2:102389765-102389787 CCCAGAAATCTGATTTCCACGGG + Intronic
935690769 2:105730390-105730412 CCCTGAGCTCTGGGTTCCTCAGG - Intergenic
936102207 2:109592111-109592133 CCCTAAACTCTGCCATTCACAGG + Intronic
936126004 2:109789692-109789714 CACTGAACTCAGGTTTCCCCTGG - Intergenic
936218689 2:110581776-110581798 CACTGAACTCAGGTTTCCCCTGG + Intergenic
939803882 2:146748830-146748852 CCCTAAAGTCAGGTTTTCTCTGG - Intergenic
941047969 2:160697764-160697786 CCCTTAACTCTGGGTTTGATTGG - Intergenic
941266177 2:163366029-163366051 CCCTGAACTGTGAACTTCACAGG + Intergenic
942737927 2:179138032-179138054 TTCTGTACTCTGTTTTTCACAGG - Intronic
947487994 2:230570105-230570127 CCCTGAACCCTGTTGTTCAGGGG + Intergenic
948279100 2:236732764-236732786 CCATGAACTCTGGCTTAGACAGG - Intergenic
948674898 2:239591530-239591552 CCCTTAACACTGGGTTCCACAGG - Intergenic
949040502 2:241846427-241846449 TCCAGAACTGTGGTTTTTACTGG + Intergenic
1170774648 20:19364819-19364841 CCCAGACCTCAGGTTTTCTCTGG + Intronic
1173554187 20:43953910-43953932 TCCTGAGCTATGCTTTTCACAGG + Intronic
1174462514 20:50692546-50692568 CCCTCATCTCTGGTTTTCAGAGG - Intergenic
1174744106 20:53044791-53044813 CCCTGAACTCCTGGGTTCACGGG + Intronic
1175327917 20:58142437-58142459 CCCTGAGCCCAGGTTTCCACAGG + Intergenic
1175676840 20:60953418-60953440 AGCTGAACTGTGGTTTCCACTGG + Intergenic
1178916976 21:36710346-36710368 CCCTGACCTCGGCTTTTCCCTGG + Intronic
1182566810 22:31206226-31206248 CACTGAACTCTGGTGTTGACAGG - Exonic
1184508252 22:44917108-44917130 GGCTCAGCTCTGGTTTTCACGGG - Intronic
1184938483 22:47742072-47742094 CACTGGACTCTGGTCATCACTGG + Intergenic
949373126 3:3356670-3356692 GCCTCATCTCTGATTTTCACAGG + Intergenic
949667071 3:6351970-6351992 TCCTGTGCTCTGGTTTTCAGTGG + Intergenic
949970534 3:9399006-9399028 CCCAGACCTCTGGGTTCCACTGG + Intronic
950609748 3:14118473-14118495 CCCTGAACTGTCCTTCTCACTGG - Intronic
951355771 3:21665028-21665050 CCCTTTGCTCTGGTCTTCACAGG - Exonic
953457405 3:43054091-43054113 CCCTGGACTCTAGTTTTGACAGG - Intronic
955097526 3:55814547-55814569 GCCTGAGCTATGGTTTTCAAAGG - Intronic
955461787 3:59190783-59190805 ACCTTAACTCTGGTTTCCAAAGG - Intergenic
956362896 3:68467860-68467882 CCCTGAACTCTTTTTTCAACTGG - Intronic
961938715 3:130614080-130614102 CCCTGTATTCTGGTTTTCAAGGG + Intronic
964445344 3:156752254-156752276 CCTTCAACTCTGGATTTAACAGG - Intergenic
966372856 3:179266670-179266692 CCCTGAAGTGTGATTTGCACGGG + Intronic
967448806 3:189598674-189598696 CCCAGCCCTCTGGTTCTCACTGG - Intergenic
969153590 4:5191129-5191151 CCTTAAACTCTGGTTTTCCCTGG + Intronic
970940043 4:21621314-21621336 CCCTGAAGTGTGCTGTTCACAGG + Intronic
971011736 4:22445412-22445434 TCCAGAACTCTGGTGTTCAGTGG - Intronic
972528218 4:39937068-39937090 CCCTGAGCTTTAGTGTTCACAGG + Intronic
974890016 4:67870421-67870443 CTCTTACCTCAGGTTTTCACAGG + Intronic
975953896 4:79812261-79812283 CCCTAAACTCTAGTTTCCAGGGG - Intergenic
976531784 4:86162822-86162844 CCCTGAACCTTCCTTTTCACTGG + Intronic
976915322 4:90366727-90366749 CCCTTAAATCCAGTTTTCACTGG - Intronic
978471531 4:109072985-109073007 CCCTGAAATCAGGTTTTATCAGG + Intronic
978767948 4:112423604-112423626 TCCTGAAGTATAGTTTTCACAGG + Intronic
979558351 4:122076174-122076196 CACTGAACTCTGGTGTTGACAGG + Intergenic
980937781 4:139242609-139242631 CCTTGACCTGTGGTTTTCTCTGG + Intergenic
981777857 4:148390758-148390780 TCCTGAACTCAGATTTTGACAGG + Intronic
982153741 4:152494280-152494302 CCAAGTACTCCGGTTTTCACTGG + Intronic
982511933 4:156293310-156293332 CTCTCAACTCTTGTTCTCACTGG + Intergenic
986553580 5:8986000-8986022 CCATGAACACTGATTTTCACAGG + Intergenic
987317798 5:16740311-16740333 CCCTGAATTAACGTTTTCACGGG - Intronic
991966777 5:72100002-72100024 CCCTGAATTTTGGTATTCACAGG + Intergenic
993063605 5:83072075-83072097 GCTTGAACTCTGTTTTCCACTGG + Intronic
994174457 5:96696339-96696361 CCTTGAGCTCTGGTTTCCTCAGG - Intronic
996261434 5:121474715-121474737 CCCCTAACTCTGTTTTTAACTGG - Intergenic
997843484 5:137264134-137264156 CCCTGGGCTCTGGCTGTCACCGG - Intronic
1001761284 5:174210258-174210280 GCCAGGACTCTGGGTTTCACAGG + Intronic
1002163797 5:177332516-177332538 CCCAGGAGTCTGGTTTTAACTGG - Intronic
1004901232 6:20196099-20196121 CCCCGAACTCTCATTCTCACGGG - Intronic
1006399473 6:33808260-33808282 CCCTGAACTCTGCCTTTGTCTGG - Intergenic
1007620670 6:43212465-43212487 CCCTGAAGTCCGGTTTATACAGG + Intronic
1008938714 6:57021434-57021456 TCCTGAGCTCAGGTTGTCACTGG + Intronic
1008952787 6:57178712-57178734 TGATGAAATCTGGTTTTCACAGG + Intronic
1014252214 6:119126889-119126911 CCCTGAAGTCTGGCTGTCTCTGG + Intronic
1018408408 6:163513888-163513910 CCCTGAGCCCTGGTGTGCACAGG + Intronic
1018608885 6:165626974-165626996 CTCTGAACTCTGGCTTTTCCAGG - Intronic
1018787173 6:167117103-167117125 CCCTGAACTCTGGTTTTCTAAGG - Intergenic
1018859500 6:167700465-167700487 CCCTGGACTCTGCTGTTCATCGG - Intergenic
1019219012 6:170460365-170460387 CACTGAACTGTGGCTTTCCCAGG - Intergenic
1019553199 7:1614179-1614201 CCCTGAACTGGGGTTTTTAAGGG - Intergenic
1024594119 7:50917776-50917798 CCCTGAGCTCTGGGGTTCAAGGG - Intergenic
1025113844 7:56241025-56241047 CCCAGGACTCTGGATTGCACAGG + Intergenic
1025849338 7:65233193-65233215 CCCTGAAGTCTGGTCATCCCTGG - Intergenic
1027818764 7:83015282-83015304 CCCAGAAATTTGATTTTCACAGG - Intronic
1028617967 7:92791270-92791292 CCCAGATCTTTGGTTTTCAGAGG + Intronic
1029278079 7:99419457-99419479 CCCTGGACTCTGGACTTCGCAGG + Exonic
1030065575 7:105656392-105656414 CCCTGACCTCTGGCTCCCACAGG + Intronic
1030399402 7:109029402-109029424 CCATTAACTATGGTTTTCAGTGG + Intergenic
1030505953 7:110422643-110422665 CCATAAACTCTGGTTTTTATTGG - Intergenic
1033201789 7:139379282-139379304 GCCTGAACTCAGGATTTCAAAGG + Intronic
1033883497 7:145916550-145916572 CCCTGAAGTCTGGCTGTCTCTGG - Intergenic
1035037807 7:155906797-155906819 CCCTGGACTCTGGTTCTCCCTGG + Intergenic
1035082272 7:156226669-156226691 GCTTGAACTTTGGTTTTCAGTGG - Intergenic
1035906698 8:3519053-3519075 TCCTTAACTCTGGTTTTAAGAGG - Intronic
1036290438 8:7483688-7483710 CGATGAACTCTGGCTCTCACTGG + Intronic
1036331048 8:7827847-7827869 CGATGAACTCTGGCTCTCACTGG - Intronic
1036392043 8:8332110-8332132 CCCTGAAATGTGGACTTCACAGG + Intronic
1040414707 8:47186105-47186127 CCCTCATCTCTGATTTTCATAGG + Intergenic
1041603148 8:59746049-59746071 CCCTGAACCCTAATTTTCACAGG - Intergenic
1043115103 8:76241156-76241178 CCATGACCTCTGCTCTTCACAGG + Intergenic
1043931862 8:86100507-86100529 GTCTGAACTCTGGCTTTAACTGG - Intronic
1043974109 8:86565727-86565749 CCTTGAACTCTGCTTTACTCTGG + Intronic
1048160759 8:132018910-132018932 GCCTAAACTCAGGTTTTCGCTGG - Intergenic
1048499318 8:134961289-134961311 TCCTAAACTTTGGTTTTCCCAGG - Intergenic
1049005288 8:139851556-139851578 CCCTGAACTCTGGTCTCCAGAGG + Intronic
1051664585 9:19456790-19456812 CCCTGAGCTCTGGTCTTCAAAGG - Intergenic
1056142390 9:83695740-83695762 ACCTGAACTCTGATTTTTCCAGG - Intronic
1056205710 9:84317420-84317442 CCCTGTACGCTGGTTTTAAGTGG + Intronic
1056570769 9:87812777-87812799 CCAGGAACTCTGGTTTTTACTGG + Intergenic
1057259176 9:93574981-93575003 ACCTGAATTCCGGTTGTCACTGG - Intergenic
1060451699 9:123748682-123748704 GCCTGATCTTTGCTTTTCACTGG - Intronic
1061083562 9:128386310-128386332 CCCTGAGGTCTGGGTTTCAGAGG - Intronic
1061102181 9:128500347-128500369 CCCTGAACCCATTTTTTCACTGG - Exonic
1061541676 9:131280861-131280883 CCCTGATCCCTGGGTTTCTCTGG - Intergenic
1061543185 9:131289262-131289284 CCGTGAGCTCTGATTTCCACCGG - Intergenic
1061592095 9:131604134-131604156 GCCTGCACTCTGGTCTTCCCAGG + Intronic
1062480677 9:136749449-136749471 TCCTGCACTCTGGTGGTCACAGG - Intergenic
1185501528 X:600267-600289 CTCAGGACTCTGGTTTGCACAGG - Intergenic
1185839440 X:3375062-3375084 CCCCTAACTCTGATTTCCACTGG + Intergenic
1188513035 X:30957393-30957415 CCTTGCCCTCTGGTTTCCACTGG - Intronic
1192544205 X:71999240-71999262 CCCTAATCTCTGATTTTCTCAGG + Intergenic
1192579871 X:72272082-72272104 TCCTCAACTCTGTTTTTCAGAGG - Exonic
1193532651 X:82674851-82674873 CCCTGAAGTCTGGTCATCTCTGG + Intergenic
1193769894 X:85576004-85576026 CCCTGTGTTCGGGTTTTCACTGG + Intergenic
1194956244 X:100184200-100184222 CCCTAAAATATGGTTTTCAGGGG + Intergenic
1196633843 X:117976786-117976808 CTCTGAACTGTGCATTTCACAGG - Intronic
1197699225 X:129585111-129585133 TCCTGAACTCTAATTTTCAAAGG - Intronic
1198074553 X:133182049-133182071 CCCTGAACTCTGGACTTCAGAGG + Intergenic
1199075492 X:143520893-143520915 TCCTGGACTCTGGTGTCCACTGG - Intergenic
1201151107 Y:11096133-11096155 ACCTGGGCTCTGGTGTTCACTGG - Intergenic
1201408265 Y:13671624-13671646 GGCTGAACTATTGTTTTCACAGG - Intergenic