ID: 1156108493

View in Genome Browser
Species Human (GRCh38)
Location 18:33694238-33694260
Sequence AGCGTTCTGCAAGATGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156108491_1156108493 -3 Left 1156108491 18:33694218-33694240 CCAGACATGCCTTTGTGCATAGC 0: 1
1: 0
2: 0
3: 11
4: 88
Right 1156108493 18:33694238-33694260 AGCGTTCTGCAAGATGTGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156108493 Original CRISPR AGCGTTCTGCAAGATGTGCT TGG Intronic
902324364 1:15689420-15689442 AGGGTTCTGCAAGATGCGGCTGG + Intronic
903579933 1:24363171-24363193 AGCCTTCTGCAGGCTGTCCTTGG - Intronic
919031027 1:192242741-192242763 AGCCTTCTGCATAATATGCTTGG - Intergenic
919102313 1:193109774-193109796 AGAGTTCTGCTAGATGTCCTTGG + Intergenic
1065334517 10:24642575-24642597 AGCATTCTGCACTATGTGATCGG + Intronic
1075762389 10:124866520-124866542 TGCGTTCTGAAAGGTGTGCAGGG + Intergenic
1076519043 10:131068318-131068340 AGCGTTCTTAAAGCAGTGCTTGG - Intergenic
1080555307 11:33410814-33410836 AGGGATTTGCAAGATGTGTTTGG + Intergenic
1086986583 11:93257072-93257094 ACCCTTCTGCAAGATGTGGTGGG - Intergenic
1102733313 12:115134453-115134475 ACAGTTCTGCAAGCTGGGCTGGG + Intergenic
1106844619 13:33725011-33725033 AGCTTTCTGCAGGATTTTCTGGG - Intergenic
1110972577 13:81783699-81783721 AATGGTCTGCAAGATGTGCACGG + Intergenic
1117140314 14:52784536-52784558 AGCCTTCTCCAGGATGTGTTGGG + Exonic
1135466024 16:22685640-22685662 AGCCTTCTGAGAAATGTGCTGGG + Intergenic
1136080193 16:27847307-27847329 AGTGTTCTCCAAGATTTCCTTGG - Intronic
1137837592 16:51607910-51607932 TGTTTTCTGGAAGATGTGCTTGG + Intergenic
1141887220 16:86900767-86900789 AGCTTTCTGCAAACTGTGATAGG + Intergenic
1156108493 18:33694238-33694260 AGCGTTCTGCAAGATGTGCTTGG + Intronic
1157931901 18:51832650-51832672 AGCGTTCTCCAGGCTGTGCCTGG + Intergenic
929828266 2:45327503-45327525 ACGGTTCTGCAAGCTGTGCAAGG - Intergenic
943593132 2:189822386-189822408 AGCCTTCTCCAGGATGTGTTGGG - Intronic
946133087 2:217622663-217622685 AGTGTTCTGCAAAATGTATTAGG - Intronic
1168851818 20:982103-982125 ATCATTCGGCAAGCTGTGCTGGG + Intronic
1170566142 20:17607688-17607710 AGCGCTTTGCAAGATGAGCGTGG - Exonic
1172388875 20:34552722-34552744 GCAGTTCTGCAAGATGTGGTCGG + Intronic
1183988089 22:41580265-41580287 AGGGTTCTGGAAGATGAGCTGGG + Intronic
1185269498 22:49922619-49922641 CGAGTCCTGCAAGACGTGCTCGG + Exonic
952303868 3:32128283-32128305 TTCATTCTGCAAGTTGTGCTTGG + Intronic
958853731 3:99359212-99359234 AGAGTTCTGCAAGTTGTGCAAGG - Intergenic
959973262 3:112430536-112430558 AGTGATCTGCAAAATGTCCTGGG - Intergenic
961462094 3:127057026-127057048 AGCCTACTGGAAAATGTGCTAGG - Intergenic
966742940 3:183250874-183250896 AGCTTTCTGCAACCTGTGATGGG + Intronic
976365472 4:84228424-84228446 AGTGTCCTGCAAGATGTCCTTGG - Intergenic
980593417 4:134922064-134922086 AGTCTACTGCAATATGTGCTAGG - Intergenic
980979558 4:139642623-139642645 AGGGTTCTGCCAGATAGGCTGGG - Intergenic
982757439 4:159238817-159238839 AGCGTTCTGCAGGAAGTTTTAGG + Intronic
986576125 5:9214544-9214566 GGGTTTCTGCAAGATGTGGTGGG + Intronic
988552486 5:32209393-32209415 AGGGCGGTGCAAGATGTGCTTGG + Intergenic
989743816 5:44804090-44804112 ATAGTTCTGCAAGATGTTCCTGG - Intergenic
994824160 5:104691887-104691909 AGGGTCCTTCAAAATGTGCTGGG - Intergenic
995278030 5:110300100-110300122 ACAATTCTGCAATATGTGCTGGG + Intronic
999410180 5:151343653-151343675 AGAATACTGCAAGATGGGCTTGG + Intronic
1001332089 5:170769554-170769576 AGTGTTCTGCAAGCTGTTTTAGG - Intronic
1018727501 6:166625384-166625406 AGGGTTCTGCAAGGAGGGCTGGG - Intronic
1019539981 7:1547105-1547127 GGCGTCCTGCACGATGTCCTGGG + Exonic
1019913759 7:4117560-4117582 AGAGTTCAGCAGGAAGTGCTGGG + Intronic
1021308528 7:19062358-19062380 AAAGTTCTGCAGAATGTGCTGGG + Intronic
1025979039 7:66392969-66392991 AGGGCGGTGCAAGATGTGCTTGG - Intronic
1028088262 7:86664676-86664698 AGCCTTGTGCAAGCTGTACTGGG - Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1031875538 7:127135901-127135923 AGCATTGTGCAAGATGTAGTTGG - Intronic
1035232812 7:157476569-157476591 AGCGTCCTGCACGGTGGGCTGGG + Intergenic
1035232821 7:157476601-157476623 AGCGTCCTGCACGGTGGGCTGGG + Intergenic
1039237028 8:35513055-35513077 AGTGTGCTGCAAGGTGTGCATGG - Intronic
1039751854 8:40486124-40486146 AGCATGCTGCAAGCTGTCCTGGG + Intergenic
1058851330 9:109013912-109013934 AGACTTCTGGAAGCTGTGCTGGG + Intergenic
1059325464 9:113501591-113501613 TGGGCTCTGCAAGGTGTGCTCGG + Intronic
1060574323 9:124675866-124675888 AGCGTTCTCCAAGAGAGGCTAGG + Intronic
1188985448 X:36764746-36764768 AGTATACAGCAAGATGTGCTTGG - Intergenic
1190954872 X:55183010-55183032 AGCGTACTGGAAAGTGTGCTTGG - Intronic
1198037411 X:132814766-132814788 AGGGTTTTGCAAGATGTCCTGGG - Intronic