ID: 1156111912

View in Genome Browser
Species Human (GRCh38)
Location 18:33738577-33738599
Sequence CTGTCTGTGCAGAAACTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 288}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156111912 Original CRISPR CTGTCTGTGCAGAAACTGGA AGG (reversed) Exonic
900354595 1:2254195-2254217 CTGATTGTGAAGAATCTGGAAGG + Intronic
900420130 1:2552689-2552711 CTGTCCCTGCTGAACCTGGAAGG + Intergenic
900424300 1:2568969-2568991 CTGTCCCTGCTGAACCTGGAAGG - Intergenic
902584361 1:17429189-17429211 CTGTCTCTGCAGAAACTTGAAGG - Exonic
905195002 1:36269155-36269177 CTGTGTGTTCAGAAATTGGAGGG - Intronic
906301756 1:44687513-44687535 CTCTGTGAGGAGAAACTGGAGGG + Intronic
906683914 1:47750393-47750415 CTGTCAGAGCAGAAGCTGCAAGG - Intergenic
908637727 1:66186928-66186950 CTGAATGGGCACAAACTGGAAGG - Intronic
909549718 1:76884188-76884210 CTGTCTGCACAGACACAGGAGGG - Intronic
910043000 1:82875855-82875877 CTGCCTGTCCATAAAATGGAGGG + Intergenic
910896382 1:92074287-92074309 CTGTCTGAACAAAAACTGTATGG - Intergenic
911008501 1:93253415-93253437 CTGTCTGTGCAGGGACTTGCTGG - Intronic
911404563 1:97420477-97420499 GTGGCTCTGCAGAAACTTGATGG - Intronic
915060986 1:153184799-153184821 CTGAATGTGCAAAAACTGGAAGG - Intergenic
915601990 1:156928133-156928155 AAGTCTGTGCAGAAATCGGAGGG - Intronic
916006971 1:160671212-160671234 CTGTCTGAACAAAAACTGTATGG + Intergenic
917864895 1:179184921-179184943 CTGTCTGAACAAAAACTGTATGG + Intronic
920827039 1:209431935-209431957 CTGTCTGTGCAGCAGGTGCAAGG + Intergenic
921184935 1:212662075-212662097 CTGAATGGGCAAAAACTGGAAGG + Intergenic
921766703 1:218981133-218981155 ATGTCTGAGCAGAGACTGAAGGG - Intergenic
923929045 1:238672388-238672410 CTGTCTGGGCAGAGACTGAGGGG + Intergenic
924209637 1:241751341-241751363 CTGTTTGCCCAGAAACTGGAAGG + Intronic
924883403 1:248187751-248187773 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883415 1:248187816-248187838 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883427 1:248187881-248187903 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883439 1:248187946-248187968 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883491 1:248188207-248188229 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883503 1:248188272-248188294 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883515 1:248188337-248188359 CTCTCTGAGCAGAAGCAGGAGGG + Intergenic
924883527 1:248188402-248188424 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883539 1:248188467-248188489 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883551 1:248188532-248188554 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883563 1:248188597-248188619 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883575 1:248188662-248188684 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883587 1:248188727-248188749 CTCTCTGAGCAGAAACAGGATGG + Intergenic
924883599 1:248188792-248188814 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
1063684507 10:8224004-8224026 CTCTCTGTGCAGTATTTGGAAGG - Intergenic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1066328468 10:34391435-34391457 CTGTCTGAACAAAAACTGTATGG - Intronic
1067438710 10:46296319-46296341 CTCTGTGTGCAGAATCTGCAAGG + Intronic
1069197474 10:65570892-65570914 CTGTCTGTCCTGAAAAAGGAAGG - Intergenic
1069663997 10:70142961-70142983 GTATCTGAGCAGAAACTTGAAGG - Intronic
1070951755 10:80436781-80436803 CTTTCTGTGTAAAAACTGGTTGG + Exonic
1071827083 10:89336103-89336125 CTGTCTCTGCAAAAAAAGGAAGG + Intronic
1073939624 10:108680884-108680906 ATCTCTGTGCAGAAAGTGGCTGG - Intergenic
1075785634 10:125048277-125048299 CTGTCTCTGCAGCCTCTGGAAGG - Intronic
1076763255 10:132616137-132616159 CTGTCCTTGCAGCCACTGGAGGG + Intronic
1077573503 11:3358182-3358204 CTGTCTGCACAGTTACTGGAGGG + Intronic
1081064351 11:38521646-38521668 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1083124030 11:60545148-60545170 CTATCTGTGCAGGAACTTGCTGG + Intergenic
1084469613 11:69349541-69349563 CTACCAGTGCAGAAACTGAAAGG - Intronic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1087609764 11:100420386-100420408 ATGCCTGGCCAGAAACTGGAAGG - Intergenic
1089484378 11:118833544-118833566 CTGTCTGAACAAAAACTGTACGG - Intergenic
1091327004 11:134699041-134699063 CGGTGTGTGCACAAAATGGATGG + Intergenic
1094857341 12:34413587-34413609 CTGTTTTTGTAGAAACTGCAGGG - Intergenic
1094866875 12:34544556-34544578 CTGTTTTTGTAGAAACTGCAAGG - Intergenic
1096263714 12:50108051-50108073 CTGAATGGGCAGAAACTGCAGGG + Exonic
1096920391 12:55078918-55078940 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1097167395 12:57093162-57093184 CTGTCTGGGGAGAGTCTGGATGG + Exonic
1099101535 12:78447473-78447495 CTGTCTGATCAAAAACTGAATGG + Intergenic
1099737448 12:86588043-86588065 CTGAATGGGCACAAACTGGAAGG - Intronic
1100613089 12:96208501-96208523 CTTTCTGTGAAGGAGCTGGAAGG + Intronic
1101625848 12:106440448-106440470 CAGATTGTGCAGGAACTGGAAGG - Intronic
1102823571 12:115927634-115927656 ATGTCTGAGCAGAGACTGGGAGG + Intergenic
1104205560 12:126635131-126635153 CTGTCTGTGCTGAAAGTGAAAGG - Intergenic
1104795048 12:131511473-131511495 CTGTCTATTCAGAGACAGGACGG - Intergenic
1105279915 13:18957524-18957546 GTGTCTGTGCAGAAACAACAGGG - Intergenic
1106458557 13:29948590-29948612 CTGTCAGTGCAGGAAGTGAAAGG + Intergenic
1106546991 13:30739286-30739308 CTGCCTTTGCAGAGACTGGAGGG + Intronic
1106605106 13:31221783-31221805 CAGTCTGTGAAGAAAATTGAAGG + Intronic
1108565428 13:51692288-51692310 CTGAATGGGCAAAAACTGGAAGG - Intronic
1112854125 13:103745442-103745464 CTGTATGTGTTGAAACTTGAGGG - Intergenic
1114201774 14:20527851-20527873 CTGTCTGAGCAAAAACTGTATGG - Intergenic
1114341365 14:21748609-21748631 CTGTGAGTGCTGAAACAGGATGG + Intergenic
1115063254 14:29220704-29220726 CTGTCTGTGCATAGAGAGGAGGG + Intergenic
1116026681 14:39523651-39523673 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1116226059 14:42153770-42153792 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1117640186 14:57790041-57790063 CTGAATGGGCAAAAACTGGAAGG + Intronic
1119666025 14:76485743-76485765 CTGTCTGTGCAGGAACTAGATGG - Intronic
1119689286 14:76658209-76658231 CTGTCTGTGGAGAGAGTAGAAGG + Intergenic
1121396302 14:93626282-93626304 GTGTAGGTGCAGAAGCTGGAAGG - Intronic
1121545232 14:94758373-94758395 TTGGCTGGGCAGATACTGGAAGG - Intergenic
1202884460 14_KI270722v1_random:91366-91388 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1125296868 15:38212688-38212710 TTGTCTGTTCAGAAACTGTCTGG - Intergenic
1126438849 15:48665207-48665229 CTGTCTATCCAGAAACAGAAAGG + Intergenic
1126731422 15:51687052-51687074 TTGTCTGGGCAGAATCTGGCCGG + Intronic
1127359279 15:58230667-58230689 TGTTCTCTGCAGAAACTGGAAGG + Intronic
1127599203 15:60518451-60518473 CGGGCTTTGCAGACACTGGAGGG + Intronic
1128001229 15:64194173-64194195 CTGTCTGTGCTCCTACTGGATGG + Intronic
1128066115 15:64765606-64765628 CAGTCTGGGCAAAAACTGGAAGG + Intronic
1129361531 15:75027657-75027679 CTGTTAGTGGAGAGACTGGAGGG - Intronic
1132516108 16:366756-366778 CTGGCTCTGCAGGTACTGGAAGG - Intergenic
1132544351 16:526505-526527 CAGTCAGTGCAGAAGCTGGCAGG - Intergenic
1132781566 16:1629271-1629293 CTGCCTGTGCAGAGACAGGGAGG - Intronic
1133642183 16:7727635-7727657 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1135674881 16:24406856-24406878 CCTTGTGGGCAGAAACTGGAGGG - Intergenic
1135941610 16:26826873-26826895 CTGTCTGATCAGAACCTGCATGG + Intergenic
1136576075 16:31126199-31126221 CTGTTTGTGCAGAAGCATGAAGG + Intronic
1137371814 16:47913895-47913917 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1138124614 16:54428593-54428615 CTGTCTGCCCAGCAGCTGGAGGG + Intergenic
1138620396 16:58206551-58206573 CTGTCTCTGCATAAATTGGCTGG - Intergenic
1138979972 16:62256215-62256237 CTGTATGAGAAGAAACGGGAAGG + Intergenic
1140337687 16:74124791-74124813 CTGTCTGTACAATAACTGGGAGG + Intergenic
1140809843 16:78566553-78566575 CTGTCTGTGCTGAGGCTGGGAGG + Intronic
1141705012 16:85659999-85660021 CTGGCTGGGCAGACACTGGAAGG + Intronic
1141852677 16:86658143-86658165 CTGTTTGTTCATAAACTGGGAGG - Intergenic
1144121515 17:12158537-12158559 CTGGCTGTGGAGAAAGGGGAAGG - Intergenic
1145531398 17:24416621-24416643 CTCTTTTTGCAGAAACTGCAAGG + Intergenic
1145723762 17:27097616-27097638 CTGGCTGTGCAGAAACTTTTTGG + Intergenic
1146237456 17:31180642-31180664 CTGAATGGGCAAAAACTGGAAGG + Intronic
1147783941 17:42964526-42964548 TTGTCTGCGCAGAAGCAGGAGGG + Intronic
1152254673 17:79230846-79230868 CTGTCTCTGCAGTAACTGCCCGG - Intronic
1154033296 18:10773064-10773086 CTGGCTGTGCAGAATCTCAAAGG - Intronic
1155176931 18:23308701-23308723 CTGTCTGAGCAGAGACCAGAAGG - Intronic
1155999497 18:32369372-32369394 CTGTCTGTGCTGAAATTAGAAGG - Intronic
1156111912 18:33738577-33738599 CTGTCTGTGCAGAAACTGGAAGG - Exonic
1157211007 18:45742004-45742026 CACTCTGTGCAGGAACTGCATGG - Intronic
1158190077 18:54817714-54817736 CTGACTGTGTAGAAGGTGGATGG - Intronic
1158713478 18:59857841-59857863 CTGTATGTGTAGATTCTGGAAGG + Intergenic
1159004808 18:63002432-63002454 GTGGCTGGGCAGAGACTGGAAGG + Intergenic
1159748980 18:72277045-72277067 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1160253181 18:77221918-77221940 CAGTCTATGCAAAATCTGGAAGG + Intergenic
1161591138 19:5129639-5129661 CTTTCAGTGCTAAAACTGGAAGG - Intronic
1162883210 19:13676069-13676091 CAGTATCTGCAGACACTGGAAGG - Intergenic
1163315220 19:16536563-16536585 CTTTGGGTGCACAAACTGGAGGG - Intronic
1164364460 19:27560897-27560919 CTGTTTATGTAGAAACTGCAAGG + Intergenic
1165161107 19:33816946-33816968 CTGTCTCTGGAGAATCAGGAGGG - Intergenic
1165497754 19:36163613-36163635 CAGTCTGTGCAGAGACTGAGAGG + Intergenic
1166273341 19:41732735-41732757 CTGTCTGTGCACAAAGTTTAAGG + Intronic
1166457451 19:42953893-42953915 CTGTCTGTGCACAAACATCAAGG - Intronic
1166488365 19:43234187-43234209 CTGTCTGTGCACAAACGTCAAGG - Intronic
1166495039 19:43294666-43294688 CTGTCTGTGCACAAACGTCAAGG - Intergenic
1166933641 19:46317594-46317616 ATGTCTGAGCTGAGACTGGAAGG - Intronic
1168419429 19:56191533-56191555 ATGTCTTTGCGGAAACTGGATGG + Intronic
1168421571 19:56207552-56207574 ATGTCTTTGAGGAAACTGGATGG - Intronic
1202633613 1_KI270706v1_random:22741-22763 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1202652273 1_KI270707v1_random:17318-17340 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1202659868 1_KI270708v1_random:58412-58434 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
925416643 2:3674705-3674727 CTGTCTGGGCAGGACCTGGCTGG + Intronic
925590902 2:5508017-5508039 CTTTCTGGGCAGCCACTGGAAGG - Intergenic
925763224 2:7206753-7206775 CTGACTTTGCAGCAGCTGGATGG - Intergenic
926143482 2:10382842-10382864 GTGGCTGGGCAGAAACAGGAAGG - Intronic
927202437 2:20586358-20586380 CTCTGGGTGGAGAAACTGGACGG - Intronic
927277012 2:21270973-21270995 CTGGAGGTGCAGAAGCTGGAGGG - Intergenic
928635638 2:33243097-33243119 ATGTCTGGGCAGGAGCTGGATGG - Intronic
929917520 2:46148449-46148471 TTGTGTGTGCTGAGACTGGATGG - Intronic
931865085 2:66400986-66401008 CTGTCTCTCCAGATACTGGGTGG - Intergenic
931987807 2:67758253-67758275 TTCACTGAGCAGAAACTGGAGGG - Intergenic
932237683 2:70134139-70134161 CAGTCTGCCCAGAAACTGCATGG - Intergenic
932641226 2:73449237-73449259 CTGTGTGAGTAGAAACTAGATGG - Exonic
933540571 2:83636316-83636338 CTGACTGGGAAGAAACTTGAGGG + Intergenic
934120446 2:88832795-88832817 CTGCCCGTGCAGAAACTCTAGGG + Intergenic
937695036 2:124799541-124799563 CTGTCCGTGCAGAAACTCAGTGG - Intronic
937700482 2:124858101-124858123 CTGAATGGGCAAAAACTGGAAGG + Intronic
937834032 2:126453466-126453488 CTGAATGGGCAAAAACTGGAAGG - Intergenic
938069611 2:128301374-128301396 CTGTCATTGCAGACACAGGAAGG - Intronic
938294929 2:130172190-130172212 CTGTCTTAGCACAGACTGGAGGG - Intronic
938461698 2:131501645-131501667 CTGTCTTAGCACAGACTGGAGGG + Intergenic
938651164 2:133385141-133385163 CTGAATGGGCAAAAACTGGAAGG - Intronic
939213185 2:139204995-139205017 GTGTGTGTGCAGAAACTGGGGGG + Intergenic
940576805 2:155518251-155518273 CTGTCTGTGCAGAAGTTAAATGG - Intergenic
940696243 2:156983061-156983083 CTATCTGTGTATACACTGGATGG + Intergenic
941440770 2:165532606-165532628 CTGAATGGGCAAAAACTGGAAGG + Intronic
947755940 2:232565254-232565276 ATGTCTGTGCATAAACTGACAGG - Intronic
948624600 2:239261402-239261424 CCGTCTGTGCAGAGCCTGGCTGG - Intronic
948648886 2:239426536-239426558 ATGCCTGAGCAGAAACTGGAAGG - Intergenic
948858576 2:240742091-240742113 CTGGCTCTGCAGCAGCTGGAGGG + Intronic
1172133766 20:32673593-32673615 CTGTCTGTGCTGAAAGTGTGGGG - Intergenic
1172305203 20:33875635-33875657 CTTTCTGTGCAAAGACAGGAGGG + Intergenic
1172306163 20:33882309-33882331 CTGTTTGAGCAGAAGCCGGAGGG - Intergenic
1172983092 20:38959753-38959775 CTGTCTCTTCATAAACAGGAAGG + Intergenic
1173710782 20:45153767-45153789 TTGTCTGTGCAGGAACTTGCTGG + Intergenic
1174671867 20:52315716-52315738 CAGTCTTTGCAAGAACTGGAAGG + Intergenic
1176180584 20:63747597-63747619 CTGCCTGTGCAGACACTCGGAGG - Intronic
1176599878 21:8782337-8782359 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1176645827 21:9348598-9348620 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1177216249 21:18133132-18133154 ATGTCTATGCAGAAACTTTAAGG + Intronic
1177578131 21:22984468-22984490 GTGTCTAGGGAGAAACTGGATGG - Intergenic
1178639883 21:34337324-34337346 CTCTCTGGTCAGAAACTGGCCGG - Intergenic
1178694394 21:34780596-34780618 CCCCCTGTGAAGAAACTGGAAGG - Intergenic
1179895266 21:44358307-44358329 CTGTGAGCGCAGAGACTGGAGGG + Intronic
1180327343 22:11441974-11441996 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1180367101 22:11950555-11950577 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1180742915 22:18066203-18066225 CTGCATGTCCAGGAACTGGATGG + Intergenic
1180958971 22:19754183-19754205 CTGGCTGTGCAGACCCTGGCCGG + Intergenic
1182277478 22:29199955-29199977 ATGTCTGAGCTGAGACTGGATGG + Intergenic
1182348478 22:29684000-29684022 CTCTATGAGCAGAAACTGCAGGG - Intronic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183812826 22:40272222-40272244 CTGTCTGTGCACAAGGGGGAGGG - Intronic
1184638817 22:45857917-45857939 TTGCCTGTGCAGAGACTAGATGG - Intergenic
1185221694 22:49632280-49632302 CTGCCTGTGCAGTGAATGGAGGG - Intronic
950650893 3:14406015-14406037 CTGTGGGTGGAGAAACAGGATGG + Intronic
954148396 3:48645639-48645661 CTGTCTCTGTAGAGGCTGGAGGG - Exonic
954463717 3:50642286-50642308 ATGGCTGTGCAGAAACTGGATGG - Exonic
954793723 3:53150741-53150763 CTTTCCAGGCAGAAACTGGAGGG - Intergenic
956787544 3:72655129-72655151 CTGTCTGTGAAGGAATGGGAGGG - Intergenic
957092774 3:75748738-75748760 CTGAATGGGCAAAAACTGGAAGG + Intronic
957935627 3:86937782-86937804 CTGTCACTGCAGAAACTTCATGG + Intergenic
958815186 3:98906237-98906259 CTGTCTGTGCAGAAACATCTGGG + Intergenic
959080361 3:101794441-101794463 CTGGCTGTGAAGAAGATGGAAGG + Intronic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
961542953 3:127612539-127612561 CTATTTGTACAAAAACTGGATGG + Intronic
962491291 3:135896544-135896566 CATTGTGTGGAGAAACTGGAGGG + Intergenic
962871457 3:139497016-139497038 CATTCTGTGAGGAAACTGGATGG + Intergenic
963262722 3:143209179-143209201 GTCACTGTGTAGAAACTGGAAGG + Intergenic
964369843 3:155988415-155988437 CTGTCTGAACAAAAACTGTATGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965033720 3:163406967-163406989 CTGTTTGTCCAGAGACTAGAGGG + Intergenic
965442360 3:168730109-168730131 CTCTCTGTACAGAAACAGGTGGG + Intergenic
966831850 3:184017153-184017175 CCGTCTGTGCAGAAACCAAATGG + Intronic
967889838 3:194357156-194357178 CTTTTTGTGCAGGAACTGGAAGG + Intronic
968278458 3:197458291-197458313 CTGTCTGTTCAGCAGCTGGGTGG + Intergenic
1202741058 3_GL000221v1_random:56465-56487 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
968853994 4:3104740-3104762 CTGTCTGTACAGAAATTAGCTGG + Intronic
969364451 4:6686005-6686027 CTGTCTCTCCAGGAACTGGCTGG + Intergenic
969892703 4:10274563-10274585 CTGTCTTTGCAGAAACTATCTGG + Intergenic
970834007 4:20378635-20378657 CTGTATTTTCAGTAACTGGAAGG + Intronic
972616007 4:40698824-40698846 GTGTCTTTTCAGAATCTGGAGGG + Intergenic
973615034 4:52669884-52669906 CTGTCTGCGGAGAAGATGGAGGG - Intergenic
974504183 4:62746899-62746921 CTGAATGGGCAAAAACTGGAAGG + Intergenic
974759466 4:66256365-66256387 CTGAATGGGCAAAAACTGGAAGG - Intergenic
977723186 4:100264626-100264648 CTGAATGGGCAAAAACTGGAAGG - Intergenic
979010001 4:115355386-115355408 CTGTCTGTGCAGACACTCACTGG + Intergenic
979896643 4:126166008-126166030 CTGAATGGGCAAAAACTGGAAGG - Intergenic
980021353 4:127713962-127713984 CTGACTTTGCAGAATCTGAATGG - Exonic
980092706 4:128458965-128458987 CCGTCTGTGCTGTAGCTGGAGGG + Intergenic
983464562 4:168070701-168070723 CTGTGTGTGCAGAATCCTGAAGG - Intergenic
984994357 4:185414071-185414093 GTATCTGGGTAGAAACTGGAAGG + Intronic
985914458 5:2906930-2906952 CTGTCTCTGCAGAAAGATGATGG - Intergenic
986631112 5:9775168-9775190 CTTTGTGTGCAGAAAGGGGAGGG - Intergenic
989412583 5:41137418-41137440 CTGAATGGGCAAAAACTGGAAGG + Intergenic
989837695 5:46013986-46014008 CTGTATTTGTAGAATCTGGAAGG + Intergenic
990873516 5:60459619-60459641 CTGTCTGAACAAAAACTGTATGG - Intronic
991111132 5:62900882-62900904 CTGTCATTGCAATAACTGGATGG + Intergenic
994207856 5:97056149-97056171 CTGTCTGAACAAAAACTGTATGG - Intergenic
995337006 5:111011230-111011252 CTACCTGTGCAGAAACTTGTTGG + Intergenic
997070053 5:130611050-130611072 CTGAATGGGCAAAAACTGGAAGG + Intergenic
997717488 5:136052966-136052988 CTGTCTGTAGAGACCCTGGAGGG + Exonic
999798175 5:155007504-155007526 CAGCTTGTGCATAAACTGGAGGG + Intergenic
1003055035 6:2810350-2810372 CTGTCTCAGCAGAGACTGAAGGG - Intergenic
1003974203 6:11327500-11327522 TTGACTGTGAAGATACTGGAGGG - Intronic
1004902140 6:20204675-20204697 GTGTGTGTGCAGAGGCTGGAGGG + Intronic
1005391121 6:25334233-25334255 CTGTGTGTCCAGAATCAGGAAGG - Intronic
1008370459 6:50724734-50724756 CCGTCTGTGCTGCAACTGGATGG - Intronic
1009063614 6:58428287-58428309 CTGTTTTTGCAGAAACTGCAAGG - Intergenic
1009877448 6:69522475-69522497 TTTTCTGTGCAGAAACTAGTTGG - Intergenic
1013598791 6:111684941-111684963 CTGGCTCTTCGGAAACTGGAAGG - Intronic
1013617803 6:111860745-111860767 GTGTCTGGGAAGAATCTGGAAGG - Intronic
1013727126 6:113112760-113112782 TTGTCTGTGCAGAGTCTTGAAGG + Intergenic
1013871467 6:114766837-114766859 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1016149791 6:140726299-140726321 CTTTCTGTGCAACAACTGGCAGG - Intergenic
1016679864 6:146816444-146816466 CTGTCTCTACAGAAATTGGCCGG - Intergenic
1019067658 6:169315929-169315951 GTGTGTGTGCAGACACAGGAGGG - Intergenic
1020245337 7:6424903-6424925 CTGTCATTGCAGACACTGCAGGG - Intronic
1020890698 7:13874440-13874462 GTGTCAGTGCAGAATGTGGAAGG + Intergenic
1021737428 7:23653572-23653594 CTGTGTGTCAAGAAACAGGATGG + Intergenic
1022334610 7:29410685-29410707 TTGTTTTTGAAGAAACTGGAGGG + Intronic
1023651365 7:42372715-42372737 CTGTCTGAGCAAAGAGTGGAGGG + Intergenic
1023794879 7:43783366-43783388 CAGTCTGTGTAGTAACAGGAGGG - Intronic
1025525832 7:61808971-61808993 CTGTTTTTGGAGAAACTGCAAGG + Intergenic
1025549223 7:62221704-62221726 CTGTTTTTGGAGAAACTGCAAGG + Intergenic
1025576405 7:62648163-62648185 CTGTTTTTGTAGAAACTGCAAGG - Intergenic
1027560826 7:79727961-79727983 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1029580472 7:101433739-101433761 CTGTCAGAGCAGCAACAGGAGGG + Intronic
1030265212 7:107614114-107614136 CTGTCTTGGGAGAAACTGGGAGG - Intronic
1030368647 7:108673121-108673143 TGGCCTGTGCAGAAAATGGATGG + Intergenic
1030902317 7:115139928-115139950 CTATCTGTGCAGAAAAAGGAGGG + Intergenic
1032456293 7:132075725-132075747 CTGTCTCTGCAGGAACAGGGAGG + Intergenic
1032778565 7:135142555-135142577 CTGTCTTTGTAGAAAATGCAAGG + Intronic
1033380801 7:140816263-140816285 CTGTCTACACAGAAACTGAATGG + Intronic
1033562848 7:142549295-142549317 AAGGCTGTGAAGAAACTGGAAGG - Intergenic
1033899448 7:146116936-146116958 CTGCCTCTGCAGAGCCTGGACGG + Exonic
1035769775 8:2137896-2137918 CCGTCTGTGCAGAGACCTGAAGG - Intronic
1036062781 8:5342744-5342766 CTGTGTCTGCAGAATATGGAGGG + Intergenic
1036719357 8:11158699-11158721 CTGTCTGTGCACATGCTGGAGGG - Intronic
1038905365 8:31896282-31896304 CTTTCTGTGCAGAAATTTCAAGG + Intronic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1045249936 8:100474760-100474782 AAGTCTGAGCAGAACCTGGAAGG + Intergenic
1045495456 8:102704201-102704223 CTTTCTGTGCAGCAAGTGGCAGG + Intergenic
1045726682 8:105182135-105182157 CTGAATGGGCAAAAACTGGAGGG - Intronic
1046929402 8:119827359-119827381 ATGTCTGTGCAGATAAAGGATGG - Intronic
1048111785 8:131475240-131475262 CTGACTGAGCAAAAATTGGATGG + Intergenic
1048692519 8:136983632-136983654 CAGTTTGTGCAGACACAGGAAGG - Intergenic
1049198685 8:141329474-141329496 CTGTCTGGGCAGACACCGGCGGG - Intergenic
1049808505 8:144552345-144552367 CTGTCCCTGCAGAGCCTGGACGG + Intronic
1050354359 9:4769231-4769253 CTCTCTGTCCAGAAAGTTGAGGG + Intergenic
1052996491 9:34554027-34554049 CAGGCTGAGCAGGAACTGGAGGG - Intronic
1053041221 9:34874290-34874312 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1055000656 9:71446281-71446303 CTGTCTGTGCAGCATGTCGAAGG - Intronic
1055058046 9:72041527-72041549 CTGTCTTTGCAGACGGTGGAAGG + Intergenic
1055602656 9:77935850-77935872 CTGTTTCTGAAGAAACTGAAGGG - Intronic
1055969166 9:81894551-81894573 CTCTCAGAGCAGAAAGTGGAGGG - Intergenic
1057272996 9:93661045-93661067 GTGTCTGTGCAGAAACAACAGGG + Intronic
1057477087 9:95411952-95411974 ATGTCTGCACAGAGACTGGACGG + Intergenic
1061128820 9:128694905-128694927 CTGTCTGAACAAAAACTGTATGG + Exonic
1203709697 Un_KI270742v1:86395-86417 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1186954029 X:14660314-14660336 CAGTCAGTGCAGAAACTCTACGG + Intronic
1189225861 X:39412676-39412698 CTCTCTGGGGAGAAACTGCAAGG + Intergenic
1190136375 X:47803186-47803208 CACTCTGTGCAGAGACTGGGCGG + Intergenic
1190325865 X:49206583-49206605 CTGGCGCTGCAGACACTGGATGG + Exonic
1190931568 X:54953028-54953050 CTGTTTGTGTAGAAGCTGAAGGG + Intronic
1192973437 X:76257471-76257493 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1193035000 X:76939915-76939937 CTGAATGTTCAAAAACTGGAAGG - Intergenic
1193700624 X:84756233-84756255 CTGTCTGAACAAAAACTGTATGG + Intergenic
1196974794 X:121147530-121147552 CTGCCTCAGCAGAAAATGGAAGG + Intergenic
1197861607 X:130977257-130977279 CTCTCTGTGCAGAAACTCTGTGG + Intergenic
1198143919 X:133835450-133835472 CTTTCTGTGCAGAAAAAGGATGG - Intronic
1200813802 Y:7511028-7511050 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1201238641 Y:11936234-11936256 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1201274959 Y:12287998-12288020 CTGTCTGCACAGTTACTGGAAGG + Intergenic
1201464854 Y:14269361-14269383 CTGAATGGGCAAAAACTGGAAGG - Intergenic