ID: 1156123137

View in Genome Browser
Species Human (GRCh38)
Location 18:33869492-33869514
Sequence TCATTTACAAACTTAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156123137 Original CRISPR TCATTTACAAACTTAGAGCC TGG (reversed) Intronic
902148055 1:14420350-14420372 GCATTTACAAACCTTGAGCTAGG + Intergenic
906726459 1:48048103-48048125 ACATTTACAAATTTTGTGCCAGG + Intergenic
906800598 1:48733855-48733877 TCATTTCCAAACATAGTGTCTGG - Intronic
906979111 1:50609177-50609199 TTATTCACAAACCTAAAGCCTGG - Intronic
907107778 1:51899768-51899790 TCATTTACAAAATGAGTGCAGGG - Intergenic
908825269 1:68126893-68126915 TAATTTACAAAATAGGAGCCAGG + Intronic
909646645 1:77923974-77923996 TCATTTAAAAAGTGAGAGCTTGG - Intronic
910301467 1:85711297-85711319 TCATTTAAAAATTGAGAGGCTGG - Intergenic
910577159 1:88777919-88777941 TCATCTACAAAATGAGAACCTGG + Intronic
911608088 1:99931066-99931088 TTATTTACTAATTTAGAGACAGG - Intergenic
914359865 1:146925143-146925165 TCATTTACAAATTTAGTGATGGG + Intergenic
914493886 1:148174752-148174774 TCATTTACAAATTTAGTGATGGG - Intergenic
917525920 1:175788504-175788526 TCTTTTAAGAAATTAGAGCCAGG - Intergenic
917612322 1:176701231-176701253 CCTTTTACAAACTCAGATCCTGG + Intronic
920602455 1:207342242-207342264 TCATTTATTAACTTGCAGCCAGG - Intronic
922143433 1:222914136-222914158 TCTTTTAAAAACTTAAATCCTGG - Intronic
922546902 1:226464539-226464561 GCATTTACAAACCTTGAGCTAGG - Intergenic
924620239 1:245654055-245654077 TCATTCACTCACTTAGAGGCAGG - Intronic
1063189961 10:3684219-3684241 TCATTTACAAACTATGCTCCAGG + Intergenic
1063772236 10:9216655-9216677 TCATTTACAGATTGAGAGACTGG + Intergenic
1063826603 10:9905508-9905530 TCATTTACAAATTTCTGGCCGGG - Intergenic
1066716757 10:38295028-38295050 TTATTTCCAAACAAAGAGCCAGG - Intergenic
1069072930 10:64008583-64008605 CCATTTACAAACTATGTGCCAGG + Intergenic
1069967052 10:72128482-72128504 TCATTGACAAAGTGAGAGGCAGG + Intronic
1070513593 10:77183111-77183133 TCATTCAGGAACTTAGAGTCAGG - Intronic
1075115015 10:119618947-119618969 TCATTTTCAAGCTTACAGCCTGG + Intergenic
1080183845 11:29455733-29455755 TCTTTTGCAAACTCAGATCCAGG - Intergenic
1084747283 11:71181213-71181235 TTATTAACAAACTTTGAACCAGG - Intronic
1086369920 11:86146351-86146373 AGAATTACAAAATTAGAGCCGGG + Intergenic
1086433691 11:86760420-86760442 TCAAATCCAAACTTAGGGCCGGG - Intergenic
1087563936 11:99829392-99829414 TTATTTTCAAACATAAAGCCTGG - Intronic
1087945987 11:104161186-104161208 TAATTTGCAATCTGAGAGCCAGG + Intronic
1088054319 11:105556787-105556809 GCATTTACAAACTTATAGTCTGG + Intergenic
1088156182 11:106806544-106806566 TGATTTACAAAATTAGATACTGG + Intronic
1088502435 11:110496104-110496126 ACATTTACAAAGATAGAGCTGGG + Intergenic
1089880578 11:121769460-121769482 TCATTTACAAACAGTGAGCAGGG + Intergenic
1090620565 11:128557149-128557171 TCACTTACCAACATGGAGCCTGG + Intronic
1093741282 12:22692903-22692925 GCATTTACAAACCTTGAGCTAGG + Intergenic
1094454063 12:30612992-30613014 TCATTTATAAAATTAGTCCCTGG - Intergenic
1094537347 12:31333909-31333931 TAATTTAAAAACTTTCAGCCAGG + Intergenic
1094637593 12:32241532-32241554 TTAATTAAAAACTTAAAGCCAGG + Intronic
1095239050 12:39835264-39835286 TCATGTACAATCTTAGAACTGGG - Intronic
1097490200 12:60258536-60258558 ACATTTTCAAACTAAGAGTCAGG - Intergenic
1099657023 12:85506527-85506549 TCATTTAAAAACTTTGGGCTGGG + Intergenic
1101739621 12:107490840-107490862 TCATTTAAAAGCTCTGAGCCAGG - Intronic
1102368448 12:112360322-112360344 TCATTTATTTACTTAGAGACAGG - Intronic
1105803276 13:23929797-23929819 TCATTTGGAAACTTAAGGCCAGG + Intergenic
1106528988 13:30569958-30569980 GCATTTACAAACTTCTAGGCAGG - Intronic
1108249906 13:48553965-48553987 TCATTTCCCCACTTAGAACCAGG - Intergenic
1108845780 13:54677265-54677287 GCATTTACAAACCTTGAGCTAGG - Intergenic
1109642170 13:65204566-65204588 TTATTCACAAAGTTAGAGGCAGG - Intergenic
1110586032 13:77194636-77194658 TCACTTACTAACTGAGATCCTGG + Intronic
1110937857 13:81315999-81316021 TCAGATGCAAACTTAGAGACAGG - Intergenic
1112497042 13:99913495-99913517 TGATTTACAAAATGAGAGACAGG - Intergenic
1116596301 14:46851135-46851157 TCATTTAAAGACTTAGAAACAGG - Intronic
1116894693 14:50304538-50304560 CCATTTACAAAATTAGGGCCGGG + Intronic
1117498332 14:56327809-56327831 TCATTCCCACACTTGGAGCCAGG + Intergenic
1117692201 14:58319379-58319401 TCAATTAAAAACTTTGGGCCTGG - Intronic
1117727245 14:58687094-58687116 GCATTTACAAACCTTGAGCTAGG + Intergenic
1118414195 14:65515599-65515621 TCAGTTACAAAATTAAAGTCAGG + Intronic
1118712143 14:68528913-68528935 TCACTTACTAACTGAGAGACTGG - Intronic
1118912916 14:70076855-70076877 TCATTTACTGATTAAGAGCCTGG + Intronic
1120908614 14:89643981-89644003 TTATTTACTTACTTAGAGACAGG - Intergenic
1122256132 14:100478139-100478161 TCATTTACAAACTAAAACCAAGG - Intronic
1124472819 15:30003396-30003418 TCATTTAGAAACGTAGAGGGTGG + Intergenic
1125052728 15:35320310-35320332 TCATCTACACCCTTGGAGCCAGG - Intronic
1127339239 15:58023202-58023224 GCATTTAAAATCTTAGAACCAGG + Intronic
1127687011 15:61356057-61356079 TCATTCCCAAACTCACAGCCAGG - Intergenic
1128294015 15:66501803-66501825 TCCTTAAGAAACTTAAAGCCTGG - Exonic
1128953729 15:71916866-71916888 GCATTTACAAAACTAGTGCCTGG - Intronic
1132190868 15:99857224-99857246 TCTTTTACAAAATTACAGGCAGG + Intergenic
1133259049 16:4536924-4536946 TCATTTATTTATTTAGAGCCAGG - Intronic
1135510883 16:23081887-23081909 TCAGATACAAACTAAGAGCCAGG + Intronic
1138826933 16:60332188-60332210 TTATCTAAAAACTTAGAGCCAGG - Intergenic
1139945542 16:70638992-70639014 GCATTTCCTAACTAAGAGCCAGG - Intronic
1140079237 16:71728850-71728872 TCACTTAAAAACTTGTAGCCAGG - Intergenic
1143401223 17:6644659-6644681 TCACTTACAAACTTAAACCCAGG - Exonic
1144486804 17:15673123-15673145 TCATTTCCAAACATAGTTCCTGG - Intronic
1144914219 17:18709172-18709194 TCATTTCCAAACATAGTTCCTGG + Intronic
1145987543 17:29057261-29057283 TAATTTAGACAATTAGAGCCTGG - Intergenic
1146074638 17:29716847-29716869 TCATTGGCAAACTTAGAGTGGGG - Intronic
1146088636 17:29853803-29853825 GCATTTAGAGACTTAGAGCCAGG + Intronic
1146166033 17:30589587-30589609 TTATTTACTTACTTAGAGACAGG + Intergenic
1146171409 17:30636913-30636935 TTATTTACTTACTTAGAGACAGG - Intergenic
1146222314 17:31035117-31035139 TTATTTACTTACTTAGAGACAGG + Intergenic
1146344867 17:32052937-32052959 TTATTTACTTACTTAGAGACAGG - Intronic
1149706634 17:58700733-58700755 TCATTTAAAAACTTTAGGCCAGG - Intronic
1150214932 17:63462039-63462061 TCATATAGAAACTGAGAGTCAGG - Intergenic
1150245028 17:63668345-63668367 TCATATACAGACTTTCAGCCTGG - Intronic
1153560925 18:6371014-6371036 TGATTTATTAACTTAGACCCAGG + Intronic
1155455950 18:26013148-26013170 TAGTTTAAAAACTTAGAGCCGGG - Intergenic
1155567671 18:27154058-27154080 TAATTTACAAATTCAGAGGCAGG - Intronic
1156123137 18:33869492-33869514 TCATTTACAAACTTAGAGCCTGG - Intronic
1157215820 18:45782707-45782729 TCATTTACATTCTTACACCCAGG + Intergenic
1158959692 18:62579349-62579371 CCGTTTAAAAACTTTGAGCCTGG - Intronic
1163130265 19:15268057-15268079 TCAGTTCTAAACTGAGAGCCTGG + Intronic
1165587209 19:36929067-36929089 TCTTTTAAAAACTTAGAGCATGG - Intronic
1166845252 19:45723366-45723388 TCATTTATTTACTTAGAGACAGG - Intronic
926901806 2:17759626-17759648 TGATTTACATACTTAGAGAATGG - Intronic
927275264 2:21257053-21257075 TCATTTACATACTCAGAGTAGGG - Intergenic
932905560 2:75746372-75746394 TCATTTACAAGTTTGGTGCCTGG - Intergenic
933050028 2:77591170-77591192 GCATTTACAAACCTTGAGCTAGG - Intronic
933113070 2:78429257-78429279 GAATTTAAAAACTCAGAGCCTGG + Intergenic
934215621 2:90028812-90028834 TCATTTTCATCCTCAGAGCCTGG + Intergenic
938031188 2:127995226-127995248 TCATTTACAAACCAAGATCTGGG - Intronic
939493932 2:142906420-142906442 CCATTTACAAACTCAGGGCCTGG + Intronic
940764325 2:157773316-157773338 ACATTTACAAATTTTGACCCAGG + Intronic
941309360 2:163910220-163910242 ACATTTACAAACCTTGAGCTAGG - Intergenic
941707324 2:168673567-168673589 TCATGTATAAAATTAGAGGCTGG - Intronic
941826518 2:169903723-169903745 TCATTTAAAAAATATGAGCCGGG + Intronic
942660438 2:178258395-178258417 TCTTTTAAAAAACTAGAGCCTGG - Intronic
943180581 2:184535671-184535693 TAATTTCCAAACTGAGGGCCAGG + Intergenic
943365394 2:186963005-186963027 GCATTTACAAACCTTGAGCTAGG - Intergenic
943510135 2:188815048-188815070 TCATTTCTAAATTTAGAGACAGG + Intergenic
944004496 2:194887066-194887088 TGATTTCCAAACTTAGAGTCTGG + Intergenic
946362011 2:219224574-219224596 TCATTGAGAAACAGAGAGCCAGG + Exonic
947417540 2:229913143-229913165 TCATTTACAAATATTCAGCCAGG - Intronic
948313962 2:237012681-237012703 TAATTTGCAAACTTAGTGCAGGG - Intergenic
1172943872 20:38673498-38673520 GCATTTACATATTTAAAGCCAGG - Intergenic
1173072826 20:39785925-39785947 TCATTTCCATACTTACAGGCTGG - Intergenic
1173752170 20:45486059-45486081 TCAGTTACAAACTTTGCGGCAGG - Intergenic
1173909851 20:46658642-46658664 TTATTTAAAAAATTAGAGACAGG - Intronic
1177994229 21:28075744-28075766 TTCTTTACAAACTTAGAATCTGG - Intergenic
1181505589 22:23354216-23354238 GCATTTCCAAAAGTAGAGCCTGG - Intergenic
1182384799 22:29928808-29928830 TGTTTTAAAAACTTTGAGCCAGG - Intronic
1182775401 22:32827808-32827830 ACAGTGACAAACTTGGAGCCTGG - Intronic
1183325935 22:37194184-37194206 TCAGTTACAAACTTGGCGGCAGG - Intronic
1184368235 22:44066396-44066418 TAAGTTACAACCTTAGAGGCAGG - Intronic
1184927385 22:47652774-47652796 CCATTTTCAAACTGAGACCCAGG + Intergenic
1185229007 22:49669837-49669859 TGATTTACAAACCTTGAGCTAGG + Intergenic
1185229024 22:49669989-49670011 TGATTTACAAACCTTGAGCTAGG + Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
954230486 3:49213243-49213265 GCATTTACAAACCTTGAGCTAGG + Intronic
955513468 3:59704621-59704643 TCATTTTCAAAATGAGAGGCTGG + Intergenic
957585057 3:82122486-82122508 TCCTTTACAAACTCAGCACCTGG + Intergenic
958879407 3:99652803-99652825 TCATTTAAAAATTTACAGACAGG - Intronic
961496476 3:127295959-127295981 TCAGTTACAAACTGGGATCCTGG + Intergenic
962428880 3:135301282-135301304 TCATGGAGAAACCTAGAGCCAGG - Intergenic
963759840 3:149276661-149276683 TCATTTTCAAATTCTGAGCCTGG + Intergenic
964761538 3:160138881-160138903 ATATTTTCAAAGTTAGAGCCAGG + Intergenic
966375032 3:179287802-179287824 TTATTTACTTACTTAGAGGCAGG - Intergenic
966514994 3:180809734-180809756 TTATTAACAGAATTAGAGCCAGG + Intronic
966689644 3:182729504-182729526 TCATTTAAAAACTGTGAGGCCGG + Intergenic
967009426 3:185418248-185418270 TCCTTAAGAAACTTAAAGCCTGG - Intronic
973586994 4:52403090-52403112 TCATATACAAACATACAGGCTGG - Intergenic
978688714 4:111481956-111481978 TCATTAGCAAACATAGAACCAGG - Intergenic
978941671 4:114443820-114443842 TCATTTATAAACTTTGAGTCTGG + Intergenic
979405732 4:120308819-120308841 CCATTTACAAACTGCGACCCTGG + Intergenic
979631142 4:122904412-122904434 TCATCTACCAACTTAGAACTGGG - Intronic
980412049 4:132433396-132433418 TAATTTACAGAGTTAGAGCATGG - Intergenic
984206636 4:176793318-176793340 ACATTTCCAAACTTTGAGCAGGG - Intergenic
987522875 5:19010000-19010022 TCATTTCCAAAATCACAGCCTGG + Intergenic
990643597 5:57817114-57817136 GCATTGACAAGCTTAGAGACAGG - Intergenic
991632748 5:68673086-68673108 CCATTTTCAAACTTAGAAGCGGG + Intergenic
993184186 5:84595220-84595242 TCATTAATAAACTTAAAGCCTGG + Intergenic
993229836 5:85220583-85220605 TCATTTCCAATCTTATAGCTGGG - Intergenic
993532943 5:89046015-89046037 TCATTTATAAACACTGAGCCTGG + Intergenic
994239957 5:97407692-97407714 GCATTTACAAACCCAGAGCTAGG - Intergenic
994471607 5:100214967-100214989 TAATTAACAAATTTAGGGCCGGG - Intergenic
996189632 5:120523069-120523091 TAATTTAGAATCTTAGAGCCTGG - Intronic
996642596 5:125775067-125775089 TATTTTACTAACTTAGAGACAGG - Intergenic
998270387 5:140701051-140701073 GCATTTACAAAATGAGAGCGAGG + Intronic
999528919 5:152440085-152440107 TCAGTTTCAAACTGAGAGACAGG - Intergenic
1003091544 6:3107949-3107971 TCATTTACTAGCTTAGTACCTGG - Intronic
1003874580 6:10424423-10424445 TCATATACAAACCTAAAACCTGG - Intergenic
1003881289 6:10482393-10482415 GCATTTACAAACCTTGAGCTAGG + Intergenic
1005766429 6:29015856-29015878 GCATTTACAAACCTTGAGCTAGG - Intergenic
1006003078 6:30981845-30981867 TTATTTAGAAACTGAGATCCTGG - Intergenic
1006201776 6:32299621-32299643 TTATTTAAAAACTTGGGGCCTGG + Intronic
1007708320 6:43805092-43805114 TCATTTACATTCTCAGGGCCTGG + Intergenic
1007972384 6:46066158-46066180 TACTTTTCAAACTTAGAACCAGG + Intronic
1008660102 6:53658972-53658994 TCACTGACAAACCTAGAGGCAGG - Intronic
1015704717 6:136075578-136075600 TCATTTAAAAACTTAGTTCTGGG + Intronic
1016925027 6:149336094-149336116 TCATATAGCAACTTAGTGCCAGG - Intronic
1017738794 6:157386333-157386355 TTATTTAAAAACTTAGAGATGGG - Intronic
1018089408 6:160332721-160332743 TAATTTGCAAATGTAGAGCCAGG + Intergenic
1018279664 6:162172182-162172204 TCATTTAGTTACTTAGAACCAGG - Intronic
1018455610 6:163949281-163949303 CCAGTTACAAACTCTGAGCCTGG - Intergenic
1022547331 7:31201265-31201287 CCATTTACAAAGGTAGAGCAGGG + Intergenic
1023875635 7:44284894-44284916 ACATTCACAAACTGACAGCCTGG + Intronic
1026075108 7:67158926-67158948 ACATTAACAAACTTCTAGCCAGG - Intronic
1026701744 7:72653247-72653269 ACATTAACAAACTTCTAGCCGGG + Intronic
1027759085 7:82254911-82254933 ACCTTTACAAACTTAGATTCTGG + Intronic
1028992697 7:97066362-97066384 TCATTTAAAAACTATGGGCCAGG - Intergenic
1029430937 7:100529695-100529717 TGATCTACAGATTTAGAGCCAGG - Intergenic
1031962449 7:128002296-128002318 TCCTTTGCAAACTTAGACCAAGG - Intronic
1033787300 7:144748086-144748108 TCATTTATAAGCCTGGAGCCAGG - Intronic
1040045105 8:42954870-42954892 TAATTTACAAACTTAGTGACAGG - Intronic
1041356754 8:57008651-57008673 TCATTAATAACCTAAGAGCCTGG - Intergenic
1041467107 8:58167700-58167722 TCATTTACAGATACAGAGCCAGG - Intronic
1043971252 8:86530985-86531007 TCATCTACATATTTAGAGCCAGG - Intronic
1047014086 8:120703852-120703874 TACTTTACACATTTAGAGCCAGG - Intronic
1050214130 9:3303585-3303607 TTATTAACAAACTGAGAGCATGG - Intronic
1050623362 9:7477790-7477812 TCCTTAAGAAACTTAAAGCCAGG - Intergenic
1051412852 9:16809020-16809042 TCATTCACAGACTTGGAACCAGG + Intronic
1053418985 9:37965014-37965036 TTATTTAGAATCCTAGAGCCTGG + Intronic
1053437157 9:38083545-38083567 TCATTTGCACACTTTGAGTCAGG + Intergenic
1055225934 9:73995418-73995440 TTTTTTAAAAAGTTAGAGCCAGG - Intergenic
1056355783 9:85800037-85800059 TCATTCACAAATTCAGATCCTGG - Intergenic
1057236859 9:93367818-93367840 GCATTTAAAAACTTACAGCATGG + Intergenic
1058320997 9:103630859-103630881 TCATTTACCAACTAAGAACCAGG - Intergenic
1060430534 9:123547545-123547567 TCATTTAAAAAATTACAGTCAGG - Intronic
1060622390 9:125079631-125079653 TCATTTACAGACTCAAAGACTGG - Intronic
1061895670 9:133646054-133646076 TCACTTCAAAACTTGGAGCCGGG - Intronic
1187094554 X:16133156-16133178 TAATTAACAAACTCAGAGACAGG - Intronic
1188766281 X:34095912-34095934 GCATTTACAAACTTTTAGCTAGG + Intergenic
1193335425 X:80282681-80282703 TCTTTTAAAAAATTAGAGACCGG - Intergenic
1193719896 X:84974602-84974624 TCATTTTCAAACTTACCACCTGG + Intergenic
1194727916 X:97419910-97419932 TCATTTACTTACTAAGAGCATGG - Intronic
1195581588 X:106510139-106510161 TCATTTACAGACTTAGATAGTGG + Intergenic
1195968483 X:110450335-110450357 GCATTTACAAACTGAGAGGCTGG + Intronic
1196762212 X:119210305-119210327 GCATTCACAAACTTTGAGCTAGG + Intergenic
1197366922 X:125574361-125574383 TAATTTACAAACATAGATTCTGG - Intergenic
1202100487 Y:21303244-21303266 GCATTTACAAACCTTGAGCTAGG + Intergenic