ID: 1156125042

View in Genome Browser
Species Human (GRCh38)
Location 18:33894051-33894073
Sequence CCATTAGTACAGATGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156125042 Original CRISPR CCATTAGTACAGATGGGGCA AGG Intronic
905474160 1:38214068-38214090 CCTGTATTACAGATGGGGCTCGG - Intergenic
907505937 1:54918304-54918326 CCATTAGTACCTAGGAGGCAGGG + Intergenic
907517575 1:55002342-55002364 CCATTAGTGAAGATGGGGCAGGG + Intronic
910590632 1:88925399-88925421 CCATTAGTACCTAGGAGGCAGGG - Intergenic
910778521 1:90900920-90900942 CTCTTAGTTCAGATGTGGCAAGG + Intergenic
912903238 1:113675391-113675413 TTCGTAGTACAGATGGGGCAAGG - Intronic
914805140 1:150986065-150986087 CCATTATTAGAGTTGGGGCCAGG - Intronic
916174239 1:162024236-162024258 CCTTTAGCACACCTGGGGCAGGG + Intergenic
917885827 1:179383622-179383644 CCATTAGTAAATATATGGCAGGG - Intronic
919841816 1:201614641-201614663 CCATTTGTCCTGATGGGGCGGGG + Intergenic
920221636 1:204407852-204407874 CCATTGGTATATATGGGGAATGG - Intronic
920397973 1:205660289-205660311 ACATTAGCACAGCTGGGGCTGGG - Intronic
921957604 1:221000448-221000470 GAATGAGGACAGATGGGGCAGGG - Intergenic
1064047192 10:12027732-12027754 CCAGTAGTACAGTTAGGGCAGGG - Intronic
1064329542 10:14380652-14380674 CTATTATTTCAGATGGGCCAAGG + Intronic
1065328926 10:24573706-24573728 CCATTAGAACATGTGGGGGATGG + Intergenic
1065447451 10:25817925-25817947 TCATTTCTACAGATTGGGCAAGG + Intergenic
1065610031 10:27463712-27463734 CCATTAGGACACATGTAGCATGG - Intergenic
1065811242 10:29445734-29445756 CCATTAGGACACAGGGAGCATGG - Intergenic
1065877202 10:30007757-30007779 CCATCAGGGCAGCTGGGGCAGGG - Intergenic
1065908811 10:30283546-30283568 CCATTAGGACACAGGGAGCATGG - Intergenic
1065914287 10:30339632-30339654 CTGTAAGTACAAATGGGGCATGG + Intronic
1067828258 10:49595211-49595233 CCAGCAGGACAGCTGGGGCAAGG - Intergenic
1070161776 10:73871225-73871247 CCATTGGGAAAGATGGGACAAGG + Intronic
1071898098 10:90086663-90086685 TCATTAGTTAAGGTGGGGCAGGG + Intergenic
1071916649 10:90300399-90300421 TCATCAGTTAAGATGGGGCAGGG - Intergenic
1072472240 10:95723553-95723575 CCATTAGTACCTAGGAGGCAGGG + Intronic
1072935522 10:99708923-99708945 GCAGTTGTAAAGATGGGGCATGG - Intronic
1073691579 10:105815004-105815026 CCAGTATTAGAGATGGGGCCTGG - Intergenic
1075599117 10:123754292-123754314 CCATGAGTGCAGAGGGGCCAGGG - Intronic
1076666758 10:132097531-132097553 CCATGGTTACAGAGGGGGCAGGG + Intergenic
1079141865 11:17816279-17816301 CCATTAGTGCAGCTGAGACAGGG + Intronic
1079601602 11:22317100-22317122 CCATTAGTACCTAGGAGGCAGGG + Intergenic
1080473388 11:32567887-32567909 CTTTTAGTACAGATGGGGTTCGG - Intergenic
1080864471 11:36180948-36180970 CCAGTAACAGAGATGGGGCAGGG + Intronic
1084219311 11:67667720-67667742 CCATGGGTGCAGGTGGGGCAAGG - Intronic
1085940384 11:81200396-81200418 ACATTATTCCAGCTGGGGCAGGG - Intergenic
1086000382 11:81976797-81976819 CCATGATTAGAGATGAGGCAAGG + Intergenic
1089376275 11:117996876-117996898 CCAAAAGTACAGAAGGGGCAGGG - Intronic
1094397620 12:30025052-30025074 CCATTATTTCAGAGGGTGCAAGG - Intergenic
1095092063 12:38116968-38116990 CCATGAAAACTGATGGGGCACGG - Intergenic
1104469659 12:129019271-129019293 CTATTGGTTCAGATGGGGCTTGG - Intergenic
1107483258 13:40802865-40802887 GCAAAAGCACAGATGGGGCAGGG - Intronic
1110015413 13:70394173-70394195 CCTTTAGTACTGAGAGGGCATGG + Intergenic
1110544379 13:76739675-76739697 CCATTTGTAAAGATGGTGCCAGG - Intergenic
1111021592 13:82458555-82458577 CCATTAGTACCTAGGAGGCAGGG - Intergenic
1113127119 13:106991734-106991756 CCATTATTACAGATGGGTAGAGG - Intergenic
1113512834 13:110869686-110869708 CCATTAGTGCTGATGGGGAGAGG - Intergenic
1114383991 14:22237580-22237602 CCATTAGTACCTAGGAGGCAGGG - Intergenic
1118685453 14:68286221-68286243 CCAATAGTACAGATGAGATAAGG - Intronic
1119884907 14:78132072-78132094 CCACTGGAAGAGATGGGGCATGG - Intergenic
1122571929 14:102709923-102709945 GCATTAGTCCCGATGGGGCCAGG + Intronic
1125749392 15:42018615-42018637 CAATCAGTACAGCTGGGCCAGGG + Intronic
1127170768 15:56299167-56299189 CCATTGCTACTGCTGGGGCATGG - Intronic
1128362957 15:66975625-66975647 CCATTAGTACCCAGGAGGCAGGG + Intergenic
1131072282 15:89473374-89473396 CCAGGACCACAGATGGGGCAAGG - Intronic
1131538448 15:93256337-93256359 CTTTTAGTAAAGATGGGGCCAGG + Intergenic
1132918438 16:2368417-2368439 CCAGTGTTGCAGATGGGGCAGGG - Intergenic
1133055179 16:3142214-3142236 GCATTAGTGCCGATGGAGCAGGG - Exonic
1133251581 16:4485557-4485579 CCATTAGGACAGAGGAGGAAGGG + Intronic
1133495620 16:6314502-6314524 CCATGAGTTCAAATGGGGCCAGG + Intronic
1138451092 16:57093656-57093678 CCCCCAGTACATATGGGGCAGGG - Intronic
1144451053 17:15379054-15379076 TCATTTGTATAGATGGGGAAGGG + Intergenic
1148708837 17:49661436-49661458 CCATTGGCAGAGATGGGGAAGGG - Intronic
1150634371 17:66902609-66902631 GCAGTAGTACAGATGGTGGAAGG + Intergenic
1152232932 17:79123932-79123954 CCATTTTTACAGAGGGGCCAAGG + Intronic
1155226562 18:23734411-23734433 CCTTCAGTACACATGGGGCATGG + Intronic
1156125042 18:33894051-33894073 CCATTAGTACAGATGGGGCAAGG + Intronic
1156163293 18:34386477-34386499 CCATCAGTACAGCTGTGGGAAGG - Intergenic
1163606370 19:18278017-18278039 CAATTAGTAGAGAAGGGGAAGGG - Intergenic
1163944841 19:20525673-20525695 CTTTTAGTAGAGATGGGGCCAGG + Intergenic
1164173306 19:22746371-22746393 CCATTAGTACCTAGGAGGCAGGG - Intergenic
1165167883 19:33870166-33870188 CCATTGGTGGAGCTGGGGCAAGG - Intergenic
1168033534 19:53700717-53700739 ACACAAGTACAGGTGGGGCACGG - Intergenic
1168038087 19:53736355-53736377 ACACAAGTACAGGTGGGGCACGG - Intergenic
1168041245 19:53760652-53760674 TCACAAGTACCGATGGGGCATGG - Intergenic
924974378 2:159550-159572 CCATTAGTACTTAGGAGGCAGGG + Intergenic
927799470 2:26084645-26084667 CCATTGGTACAGTTTGGCCAAGG + Intronic
927987733 2:27424832-27424854 TTTTTAGTAGAGATGGGGCATGG - Intergenic
929060773 2:37922715-37922737 CCATAAGTTTTGATGGGGCATGG + Intergenic
930631285 2:53757569-53757591 CCATTAGTACCTAGGAGGCAGGG - Intronic
932917326 2:75872932-75872954 CCATTAGTACCTAGGAGGCAGGG - Intergenic
934672287 2:96222323-96222345 CCATTAGTACCTAGGAGGCAGGG + Intergenic
934715247 2:96539276-96539298 CCAAGAGGACAGATGGGGCAAGG - Intronic
936387592 2:112043997-112044019 CCATTAGTACCTAGGAGGCAGGG + Intergenic
938170170 2:129069191-129069213 CGATTCCCACAGATGGGGCAGGG + Intergenic
940585476 2:155643267-155643289 CCATGGGAACAGATGGTGCAAGG - Intergenic
945439752 2:209864592-209864614 CCATTAGAAAAGAGGGGTCAGGG + Intronic
947942584 2:234071288-234071310 GCATTAGTTTATATGGGGCAAGG - Intronic
1170166191 20:13362344-13362366 TCATCAGTTAAGATGGGGCAGGG - Intergenic
1170798855 20:19573595-19573617 GAATTAGTCCAGATGGTGCATGG + Intronic
1171139462 20:22728641-22728663 CAATTTGGACAGATGGGGCCTGG - Intergenic
1172435461 20:34926030-34926052 CCATGGGTACAGATGGAGCATGG + Intronic
1175946935 20:62563350-62563372 CCAGTAGCACAGAGGGTGCAGGG - Intronic
1176373009 21:6073799-6073821 CCCTTCTTACAGATGGGGCTTGG - Intergenic
1179259461 21:39745408-39745430 CCATTAGTACCTAGGAGGCAGGG + Exonic
1179750468 21:43464444-43464466 CCCTTCTTACAGATGGGGCTTGG + Intergenic
1181235263 22:21444674-21444696 TCATTAGTGCAAATGGGGCAGGG + Intronic
1183267812 22:36840099-36840121 CCCTCAGGACAGATGGGGCGTGG + Intergenic
1183341522 22:37284376-37284398 CCATTTGCACAGCTGGGTCAGGG - Intronic
1184462462 22:44646921-44646943 CCAGCAGTGCAGGTGGGGCAGGG + Intergenic
951171088 3:19542785-19542807 CCATTGGGACAGATGGGACTTGG - Intergenic
951201034 3:19875630-19875652 CCATTAGTACCTAGGAGGCAGGG + Intergenic
952041744 3:29269252-29269274 CAATTAGTAAAAATGTGGCAAGG - Intergenic
952922552 3:38296048-38296070 CCATTAGTACCTAGGAGGCAGGG + Intronic
954703753 3:52467365-52467387 CCTTCAGCACAGATGGGGTAGGG + Intronic
958016597 3:87945364-87945386 CCATTAGTACCTAGGAGGCAGGG + Intergenic
958040260 3:88219071-88219093 CCATTCGAACAGAAGGTGCATGG + Intergenic
958630220 3:96674180-96674202 CCATTAGTACCTAGGAGGCAGGG + Intergenic
960195967 3:114768607-114768629 CCATTAGTACAGTTAAGGCAAGG - Intronic
963915463 3:150855251-150855273 CCATTAGTACCTAGGAGGCAGGG - Intergenic
964360379 3:155889392-155889414 CCAATAGTACACAAGTGGCAGGG - Intronic
967561035 3:190920269-190920291 TCATCAGTTAAGATGGGGCAGGG - Intergenic
967623259 3:191659785-191659807 CCATTAGTACCTAGGAGGCAGGG - Intergenic
967630668 3:191740390-191740412 ACATTATCACAGCTGGGGCATGG + Intergenic
968034853 3:195539425-195539447 ACATAAGTACTGGTGGGGCATGG + Intronic
969997187 4:11324900-11324922 CCAATACTAGAGGTGGGGCATGG + Intergenic
972546388 4:40084367-40084389 CAATTACTATAGATAGGGCAGGG + Intronic
972646865 4:40976746-40976768 CTATTTATTCAGATGGGGCAAGG + Intronic
973879865 4:55259261-55259283 CCATCAGTACAGAAGCTGCATGG - Intergenic
976894473 4:90091828-90091850 CCATTATTAGAGGTGGGGCCTGG - Intergenic
978851760 4:113346278-113346300 CTATTAATACACATTGGGCATGG + Intronic
978909174 4:114045378-114045400 CCATTAGTACCTAGGAGGCAGGG - Intergenic
980157013 4:129119444-129119466 CATTTAGTACAGATGAGGCCTGG - Intergenic
980443952 4:132883273-132883295 CCATTAGTACCTAGGAGGCAGGG - Intergenic
982250532 4:153401782-153401804 CCATTTGTTCATATGGGGCATGG + Intronic
983667292 4:170196097-170196119 CCATTAGTACCTAGGAGGCAGGG + Intergenic
986611448 5:9571989-9572011 CCATTTGTACAGATGAAGAATGG - Intergenic
987487920 5:18543673-18543695 TCATCAGTTAAGATGGGGCAGGG - Intergenic
988586458 5:32511677-32511699 CCCATAGTTCAGAAGGGGCAGGG + Intergenic
988740397 5:34063798-34063820 CCATTAGTACCTAGGAGGCAGGG + Intronic
992394278 5:76357361-76357383 TCATTAGTTAAGGTGGGGCAGGG - Intergenic
995465313 5:112444932-112444954 CCATTAGTACCTAGGAGGCAGGG - Intergenic
999618435 5:153450010-153450032 CCATCAGTTAAGGTGGGGCAGGG + Intergenic
1004236498 6:13879316-13879338 CCATTAGTACCTAGGAGGCAGGG - Intergenic
1005323989 6:24681797-24681819 CCATTAGTACCTAGGAGGCAGGG + Intronic
1005380097 6:25224951-25224973 CCACAGGTACAGATGTGGCAGGG + Intergenic
1007658926 6:43470254-43470276 CCAATATCACAGATGGGTCATGG + Intergenic
1008654809 6:53601195-53601217 CCTTTAGAACAGATGGGAGAAGG + Intronic
1009544467 6:65005962-65005984 CCATTAGTACCTAGGAGGCAGGG - Intronic
1011076533 6:83444738-83444760 CCATTAGTACCTAGGAGGCAGGG - Intergenic
1011540234 6:88420482-88420504 CCATTAGTACCTAGGAGGCAGGG + Intergenic
1011771223 6:90675315-90675337 TCATCAGTTCAGGTGGGGCAGGG + Intergenic
1013021908 6:106229130-106229152 CCATTAGTACCTAGGAGGCAGGG - Intronic
1013543219 6:111131951-111131973 CCATTAGTACCTAGGAGGCAGGG - Intronic
1015043217 6:128746460-128746482 TCATCAGTTAAGATGGGGCAGGG + Intergenic
1015270986 6:131338905-131338927 TCATCAGTTAAGATGGGGCAGGG - Intergenic
1015319054 6:131850973-131850995 CCATTAGTTCAGAGTGGCCATGG + Intronic
1016032214 6:139349698-139349720 CCATTACTACAGATGAGGATAGG + Intergenic
1016122746 6:140364103-140364125 CCATGGCTTCAGATGGGGCAAGG + Intergenic
1017607498 6:156149392-156149414 CCTTTAGTAGAGATGGGGGTGGG - Intergenic
1018760714 6:166892138-166892160 CCATTAGTACCTAGGAGGCAGGG - Intronic
1021234635 7:18127445-18127467 CCAGAAGTACAGAGGGAGCAGGG - Intronic
1029156668 7:98522121-98522143 CCATATGTGCAGCTGGGGCAGGG - Intergenic
1030843846 7:114385283-114385305 CCATTAGTACCTAGGAGGCAGGG + Intronic
1031264478 7:119566588-119566610 CCATTAGTACCCAGGAGGCAGGG - Intergenic
1034378389 7:150666654-150666676 ACATTTGTACAGATGGAGCCAGG + Intergenic
1034631171 7:152531628-152531650 CCATTGGAACAGGTGGAGCAAGG - Intergenic
1034632730 7:152543286-152543308 CAATGAGGACAGGTGGGGCATGG + Intergenic
1038913804 8:31996900-31996922 CCCTTAGTAGAGATGGGGCATGG - Intronic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1042055801 8:64763935-64763957 CCATTAGTACCTAGGAGGCAGGG - Intronic
1046892693 8:119440273-119440295 AAATTAGTATAGATGGGGTAGGG + Intergenic
1047885818 8:129249066-129249088 CCAATAGTACAGGTGGGGCCTGG + Intergenic
1047992534 8:130301082-130301104 CCATTAGTTCAGATGGTGTATGG + Intronic
1051483719 9:17586424-17586446 CCATTAGTATCTATGGGGAAAGG - Intronic
1055564849 9:77557994-77558016 CCATTTGTAAAAATGGGGCTGGG - Intronic
1059863036 9:118485959-118485981 TCATCAGTTAAGATGGGGCAGGG + Intergenic
1060100529 9:120836690-120836712 CAAGAAGTACAGATGGGGCCAGG - Intronic
1185672891 X:1826086-1826108 CCATTATTGGAGATGGGGCTGGG - Intergenic
1186254386 X:7703046-7703068 CCATTAGTACCTAGGAGGCAGGG + Intergenic
1186336004 X:8589280-8589302 CCTTTATTACTGATGGGTCATGG + Intronic
1187227316 X:17386038-17386060 CCAGCAATACAGTTGGGGCAGGG - Intronic
1187233435 X:17444143-17444165 GCATTAGTACAAAGGGGACATGG + Intronic
1190106471 X:47564622-47564644 CCATCTGTAAAGTTGGGGCAAGG + Intronic
1192142480 X:68657757-68657779 CCAGTTGTGCTGATGGGGCAAGG - Intronic
1194200896 X:90951881-90951903 CCATCCGTACAGATCAGGCAGGG - Intergenic
1195584746 X:106552225-106552247 CCATTAGTACCTAGGAGGCAGGG - Intergenic
1197351606 X:125389163-125389185 TCATTAGTTAAGGTGGGGCAAGG + Intergenic
1200546747 Y:4527339-4527361 CCATCCGTCCAGATGAGGCAGGG - Intergenic
1201241902 Y:11965481-11965503 CCATAAATACAGATGGGGTATGG + Intergenic
1201711872 Y:17001158-17001180 CAAGGAGTACAGATAGGGCATGG + Intergenic