ID: 1156129396

View in Genome Browser
Species Human (GRCh38)
Location 18:33952130-33952152
Sequence ATGTGTTTGTGGTGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 495}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156129396 Original CRISPR ATGTGTTTGTGGTGGGAAGC TGG Intronic
900194801 1:1370846-1370868 ATGTGTGTGTGTTGGGGGGCAGG - Intergenic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
900827245 1:4936694-4936716 AGGTGTTTCTGTTGGGAAGTGGG + Intergenic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
902113309 1:14100818-14100840 ATGTGTTTGTGGGAGGGACCTGG + Intergenic
902137849 1:14326212-14326234 ATGTGTTGGTGGTGGGAACTCGG - Intergenic
903183342 1:21616126-21616148 GTGTGTGTGTGTTGGGAAGAGGG - Intronic
903544079 1:24112684-24112706 ATGTGTGTGTGGTGTGGTGCAGG + Intergenic
903650664 1:24919642-24919664 ACGATTTTGTGGTGGGGAGCAGG + Intronic
903761329 1:25700856-25700878 ATGGGGTTGGGGTGGGAGGCGGG + Intronic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904660928 1:32084259-32084281 ATGCCTTTGTAGGGGGAAGCAGG - Intronic
904806764 1:33137669-33137691 ATGGGCTTGGGCTGGGAAGCTGG + Intergenic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
905147901 1:35902295-35902317 CTGTTTTTGGGGTGCGAAGCAGG - Exonic
905279196 1:36838020-36838042 ATGTGATGGTGGTGGGAGGGTGG - Intronic
905308657 1:37035021-37035043 ATGGGGTTGGGGAGGGAAGCCGG - Intergenic
905807513 1:40887493-40887515 AGGTGGCTGTGGTGAGAAGCCGG + Intergenic
906679991 1:47719988-47720010 TTGTGCATGTGGTGGGGAGCAGG + Intergenic
907426877 1:54385327-54385349 GTCTGTTTTTGGTGGGGAGCAGG - Intronic
907663475 1:56414553-56414575 GTGTGTGTGTGGTGGGGGGCAGG - Intergenic
908670579 1:66543255-66543277 TTTTGTTCGTGGTGGGAACCAGG - Intronic
908729704 1:67213248-67213270 ATGTGTTTGTTGTGGGAAAGGGG + Intronic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
909820004 1:80050527-80050549 ATGGGTGAGTGGTGGGTAGCTGG - Intergenic
910130700 1:83902058-83902080 ATGGGAATGTGGTGGGAAGATGG - Intronic
910559821 1:88578397-88578419 CTTTCTTTGTGGTGGGAGGCAGG - Intergenic
911885243 1:103289466-103289488 GTGGGGTTGTGGTGGGAATCTGG - Intergenic
912325017 1:108749062-108749084 AGGTGTTGGAGGTGGAAAGCAGG + Intronic
912451028 1:109767913-109767935 ATGTGTATGTGGCGGGGAGGTGG + Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912950397 1:114116712-114116734 ATGTGGTCTTGCTGGGAAGCTGG - Intronic
913098847 1:115544865-115544887 GTGTATGTGTGGTGGGAGGCAGG + Intergenic
913547902 1:119887600-119887622 ATGTGTTTGTGAAGAGAAGAAGG - Intergenic
914978782 1:152393391-152393413 ATGTGTTTGTTGTGAGTAGCAGG + Intergenic
915067134 1:153234355-153234377 ATCTGTTTGTGCTGTGAAGCAGG + Intergenic
915836206 1:159177586-159177608 GTGTGTTTGTGGTGGCAGGGAGG - Intronic
915950736 1:160188417-160188439 ATGTGAGTGAGGTGGGAAGCAGG + Intergenic
917653683 1:177104482-177104504 ATGTGTTTGTGCTGTGACGCAGG + Intronic
918039960 1:180907984-180908006 GTGTGTGTGTGGAGTGAAGCAGG + Intergenic
918309059 1:183272563-183272585 ATGTGTTTGGGGTGGGGATGGGG + Intronic
918311936 1:183291270-183291292 ATGTGTATGTGGTGGGGTGGTGG - Intronic
918497581 1:185157235-185157257 GTGTGTGTGTGTTGGGAGGCGGG + Exonic
919899268 1:202031961-202031983 AAGTGTTTGTTGTGGGGAGCTGG - Intergenic
920035010 1:203059995-203060017 ATGTGTGTGTGTTGGGGAGGGGG - Intronic
921575086 1:216825662-216825684 AAGTGTATGTAGTGGTAAGCTGG + Intronic
922085730 1:222345057-222345079 ATGTGTGTGTGATGGGGAGGTGG - Intergenic
922093393 1:222419575-222419597 ATGTCTTTGTGGGGTGAAGCGGG + Intergenic
922818936 1:228470862-228470884 ATTGGTTTGTGGTGTGAGGCGGG + Intergenic
922850343 1:228727949-228727971 GTGTGTTTGGGGAGGGAAGTTGG + Intergenic
923162203 1:231324177-231324199 CTGTGGTGGTGGGGGGAAGCGGG + Intergenic
923221644 1:231899887-231899909 ATGTGTCTATTTTGGGAAGCAGG - Intronic
923393419 1:233536289-233536311 ATGTGTTTGAGGTGGGGTGGGGG + Intergenic
924131424 1:240912706-240912728 ATGTGTTTGTGTTGGGAGTGAGG - Intronic
924155260 1:241168748-241168770 ATGTGTGTGTGTTGGGGAGGTGG - Intronic
1062901122 10:1147725-1147747 ATGGGTGTGGGGTGGGACGCTGG + Intergenic
1064592763 10:16911389-16911411 GTGTGTTTGTGGTGGCAAAGGGG + Intronic
1064854244 10:19747573-19747595 ATATGTTTGGTGTGGGATGCTGG - Intronic
1067463265 10:46474116-46474138 AGCTGTTTGGGGTGGGAGGCAGG - Intergenic
1067623929 10:47910522-47910544 AGCTGTTTGGGGTGGGAGGCAGG + Intergenic
1069209155 10:65734240-65734262 GTGTGTTTGAGATGGGAAGAGGG + Intergenic
1069470354 10:68683236-68683258 TTGTGTTTTTGCTGGGAGGCAGG + Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069846361 10:71374527-71374549 GTGTGTGTGTTGTGGGAAGCAGG + Intergenic
1069961872 10:72083943-72083965 AGGTGTGTGGGGTGGGAAGCAGG + Intronic
1069990980 10:72315890-72315912 ATGTGTTTGAGGTAGCAGGCAGG + Intergenic
1070226784 10:74516186-74516208 ATGTGTTTGTGGTGGCAAAGAGG + Intronic
1070514679 10:77193679-77193701 ATATATTTGTGCTGGGAGGCTGG - Intronic
1070957044 10:80471056-80471078 AGGTGGTGGTGGTGGCAAGCTGG - Intronic
1071225723 10:83526304-83526326 ATGAGTCTGTGGTGGGAATTTGG - Intergenic
1071388596 10:85147085-85147107 TTGTGTTTTTGGTGGGAAGTTGG - Intergenic
1071988961 10:91081124-91081146 ATGATTATGTGGTGGGAAGCAGG - Intergenic
1072028618 10:91493023-91493045 ATGTGTATGTGATGGGAAATAGG + Intronic
1072845418 10:98825184-98825206 ATGTGTGTGAGGTGGGGAGAGGG + Intronic
1073722488 10:106188985-106189007 GTGTGTTTGTGGTGGGGTGGTGG - Intergenic
1073812702 10:107168012-107168034 TTCTGTTTGTGATGGTAAGCTGG - Intergenic
1073984070 10:109187674-109187696 AGCTGTTTGTGGTGGGAATCAGG + Intergenic
1074777825 10:116779271-116779293 TTGTGTTTGGGGTGGGCACCCGG - Intergenic
1075549524 10:123381938-123381960 ATGTAGTTGTGGTGGGTAGTAGG + Intergenic
1075690957 10:124393849-124393871 ATGTGTTGGGGGTGGGGAGGGGG + Intergenic
1075734981 10:124658999-124659021 CTGTGTCTGTGGTGGTAACCTGG + Intronic
1075959233 10:126552987-126553009 TTGTGTTTATGATGGGAAGCAGG - Intronic
1075989766 10:126825730-126825752 AGGTATTTGTGGTGGCAAGGAGG - Intergenic
1076123609 10:127956053-127956075 ATGTGTTTTTGGTTGTACGCAGG + Intronic
1076551601 10:131281794-131281816 AGGTGTTGGAGGTGGTAAGCAGG - Intronic
1076808773 10:132875692-132875714 ATGTGTGTGTGGTGTGAGGTAGG - Intronic
1076855087 10:133111876-133111898 AGGTGTCTGTGGTGGGCAGGTGG - Intronic
1076855122 10:133112002-133112024 AGGTGTCTGTGGTGGGCAGGTGG - Intronic
1077176095 11:1191471-1191493 TTGTGCTTGTGGTGGGAACAGGG - Intronic
1077601523 11:3578054-3578076 ATGTGTTTATGGTGGGGAGGCGG - Intergenic
1078085544 11:8231257-8231279 CTGTGTGTATGTTGGGAAGCTGG - Intronic
1078284413 11:9936984-9937006 ATGTGTTGGTGTTGGGAGGTGGG - Intronic
1078333377 11:10444384-10444406 ATGTGTGTGTGGTGGGCAGGTGG + Intronic
1079107499 11:17580916-17580938 CTGTGGTTGTGGGAGGAAGCAGG - Intronic
1079314848 11:19398808-19398830 GTGTGTCTGTGGGGGGAAGGAGG - Intronic
1079865665 11:25730289-25730311 ATATGTGTGTTGTGGGATGCAGG + Intergenic
1080114026 11:28601696-28601718 ATGTGATTGTGTTAGGAAGTGGG - Intergenic
1080582641 11:33656723-33656745 ATTTGTATGTTGGGGGAAGCTGG - Intronic
1083454896 11:62771950-62771972 ATGTCTTTGGGGTGGGATCCAGG + Intronic
1084257430 11:67952623-67952645 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1084312527 11:68325214-68325236 ATGTGTTTCAGGTGAGAAACAGG + Intronic
1084815340 11:71642631-71642653 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1084890600 11:72235104-72235126 ATTGGTTTGAGCTGGGAAGCAGG - Exonic
1084932060 11:72563985-72564007 CTGTGTGTGTGATGGTAAGCAGG + Intergenic
1085567551 11:77528115-77528137 ATGTGTTTGTGGGGATAGGCTGG - Intronic
1085773616 11:79346510-79346532 GTGTGTATGTGGTGGGAGGTGGG - Intronic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1087155118 11:94894505-94894527 AGGTGTCTGTGGTGGGAATGTGG + Intergenic
1087400138 11:97654682-97654704 ATGTGTATGTGGTGGGAGCAGGG + Intergenic
1087902940 11:103663100-103663122 ATGTGTGTGTGGTTGGGTGCAGG + Intergenic
1088174381 11:107034465-107034487 ATGTGTCTGTGGTGGGGACAAGG - Intergenic
1088495437 11:110427323-110427345 ATTTGTGTTTGGTGGGCAGCAGG - Intergenic
1088583849 11:111341803-111341825 ATGTGTGTGTGGTATGAGGCAGG - Intergenic
1088940047 11:114444502-114444524 ATGTGTTTTTGGTGGGGGGCTGG + Intronic
1088990314 11:114948053-114948075 GTGTGTTGGTGGTGGGGAGGGGG - Intergenic
1089103706 11:115984839-115984861 ATGGGCTTGTGGTAGGAAGGTGG - Intergenic
1089374669 11:117986100-117986122 GTGTGCATGTGCTGGGAAGCAGG - Intergenic
1089683971 11:120135121-120135143 ATGTGGTTCTGGTGGGCAGGAGG - Intronic
1090011178 11:123047221-123047243 CTGTGGTTTTAGTGGGAAGCAGG - Intergenic
1090153202 11:124406782-124406804 GTGTGTGTGTGGTGAGAAGGAGG - Intergenic
1090452430 11:126818645-126818667 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
1090480144 11:127060913-127060935 ATGGATTTGAGGTGGGAGGCGGG - Intergenic
1090568476 11:128021573-128021595 ATGTGTGTCTGCTGGGCAGCAGG + Intergenic
1090645380 11:128763132-128763154 TTGTGTCTCTGGTGGGAAGGAGG + Intronic
1092424882 12:8366948-8366970 TGGTGGTGGTGGTGGGAAGCTGG - Intergenic
1092427667 12:8387407-8387429 ATGTGTTTATGGTGGGGATGTGG - Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1096330599 12:50709049-50709071 ATATGTCTGTGGTGGGGAGCAGG + Intronic
1096428880 12:51526928-51526950 ATTTTTTTGTGGTAGGAATCTGG + Intergenic
1096599453 12:52718931-52718953 AGGGCTTTGGGGTGGGAAGCTGG + Intergenic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097299297 12:58001131-58001153 ATGTGCTTTTGGGGGGAACCCGG + Intergenic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098073762 12:66703841-66703863 ATGTGTGTGGGGTGGGGAGAGGG + Intronic
1098602605 12:72350091-72350113 ATGTGTTTGTTGAGGAAAGTTGG - Intronic
1098813187 12:75122199-75122221 ATTTGTTTGTGTTGGGGAGAAGG + Intronic
1099430976 12:82585460-82585482 ATGTGTGTGTGTTGGGTAGAAGG - Intergenic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1099935434 12:89119360-89119382 ATGTGTTTGTTGGGGGACGGGGG - Intergenic
1101213118 12:102554384-102554406 ATCTGTTGGTGGTGGGAACTGGG - Intergenic
1101571722 12:105959650-105959672 ATGTGTGTGTGTTTGGGAGCTGG - Intergenic
1101652477 12:106690066-106690088 GTGTGTGTGTTGTGGGAAGGGGG + Intronic
1101806315 12:108067323-108067345 ATGTGTTTGTGGTTGTATGCAGG + Intergenic
1103228455 12:119307878-119307900 ATGTGCCAGTGATGGGAAGCCGG + Intergenic
1103607806 12:122099873-122099895 AGGTGTTTGTAGTGAGAAGATGG + Intronic
1104353955 12:128068735-128068757 ATGTGATGGTGGTAGGAAGTGGG - Intergenic
1104578455 12:129990390-129990412 AGGTGCTTGTGGTTGGAGGCAGG - Intergenic
1108783104 13:53860783-53860805 ATGTGTTTGTCCTGGGCAGGAGG + Intergenic
1109018185 13:57048008-57048030 TTGTGTTTGTTGTGGGAACATGG - Intergenic
1109075639 13:57831845-57831867 GTGTGTTGATGTTGGGAAGCGGG + Intergenic
1109218459 13:59616669-59616691 AGGTGTTTGTGGTGGCAATGGGG - Intergenic
1109730709 13:66409744-66409766 ATGAATTTGAGATGGGAAGCAGG + Intronic
1110605221 13:77424615-77424637 ATGTGTCTGTGGTGGGAAGGGGG - Intergenic
1111166223 13:84461201-84461223 GAGTGTTTGTGGTGGGGAGGGGG + Intergenic
1111673256 13:91355537-91355559 GTCTGTTTGTGGTTGGATGCAGG + Intergenic
1112736998 13:102431357-102431379 ATGTGTTTGTGGTGGCAATGGGG + Intergenic
1113468568 13:110529286-110529308 ATGTGTATGGGGTTGGCAGCAGG - Intronic
1115446718 14:33498980-33499002 GTGTGTGTGTGGTGGGAAGGGGG + Intronic
1115888728 14:38003717-38003739 GTGTGTGTGTGGTGGGGGGCGGG + Intronic
1118001443 14:61527073-61527095 AGGTGCTTGTGCTGGGAAGCGGG + Intronic
1119064591 14:71512644-71512666 TTTTGTGTGTGGGGGGAAGCCGG + Intronic
1119382617 14:74238978-74239000 CAGTGTGTGTGGTGGTAAGCTGG - Intergenic
1119483834 14:74975729-74975751 GTGTATGTGTGGTGGGAAGGAGG - Intergenic
1120673261 14:87388608-87388630 AGGTGGTTCTGATGGGAAGCTGG - Intergenic
1121265126 14:92596857-92596879 CTGTGTTTTTGGTGGCATGCTGG + Intronic
1121481609 14:94281751-94281773 CAGTGTATGTGGTGGGAAGAAGG + Exonic
1122584238 14:102793597-102793619 ATGTGTCTGTGTTGAGAAGAGGG - Intronic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1122879470 14:104683603-104683625 GTGTGTGTGTGGTGGGGAGGGGG - Intergenic
1123037564 14:105477709-105477731 GGGTGTGTGTGGGGGGAAGCGGG + Intronic
1124792267 15:32739614-32739636 ATGTGTTTGTGGATTGAAGAAGG - Exonic
1125375086 15:39020229-39020251 GTGTGTCTGTGGTGTGAAGGGGG + Intergenic
1125477061 15:40054716-40054738 AGGGGTGTGGGGTGGGAAGCTGG - Intergenic
1126532674 15:49728131-49728153 ATGAGTTGGGGGTGGGAGGCGGG + Intergenic
1128342530 15:66832357-66832379 GTGTGTGTGTGGTGAGAGGCAGG + Intergenic
1129726043 15:77902260-77902282 CTGTGTTTGTGGTGAGGACCGGG - Intergenic
1129776569 15:78240850-78240872 ATCTCTTTGTTGTGGGAGGCAGG - Intronic
1130394098 15:83487005-83487027 ATGTGGTTGTATTTGGAAGCAGG - Intronic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1132849635 16:2019252-2019274 ATGGGTTGGTGGGGAGAAGCTGG + Intronic
1133374546 16:5273588-5273610 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
1134661994 16:15991275-15991297 GTGTGTGTGTGGTGGGGTGCGGG + Intronic
1135111033 16:19691098-19691120 ATGTGTGCGTGGCGGGGAGCGGG - Intronic
1135703941 16:24658145-24658167 GTGAATTTGGGGTGGGAAGCTGG + Intergenic
1137731279 16:50692607-50692629 ATGTGTGTGTGTTGGGAAGTGGG + Intergenic
1137731328 16:50692946-50692968 GTGTGTGAGTGTTGGGAAGCAGG + Intergenic
1137731383 16:50693291-50693313 ATGTGTATGTGTTGGGAAGCGGG + Intergenic
1137881187 16:52050208-52050230 ATGTGTTTAGGGTGGGTAGGGGG + Intronic
1138925321 16:61583241-61583263 ATTTGTTTCTGGTTGGCAGCTGG + Intergenic
1139122101 16:64033097-64033119 ATGTGTGTGTGGTGGGTGGGGGG - Intergenic
1139246860 16:65452937-65452959 ATGGGCTTGAGGTGGGAAGGAGG - Intergenic
1139304906 16:65976886-65976908 TTGTGTTTTTGGTGGGAGTCTGG + Intergenic
1140206588 16:72938496-72938518 ATGTGTTTGCGGGAGGCAGCGGG + Intronic
1140537814 16:75727024-75727046 AGGTTTTTCTGGAGGGAAGCGGG + Intronic
1140749730 16:78012209-78012231 ATGGGTTAGTGGTGGGAACTGGG + Intergenic
1142477423 17:197701-197723 ATGTGTGTGTAGTGGGAGACAGG + Intergenic
1143125066 17:4636678-4636700 AGGAGTATGAGGTGGGAAGCTGG - Intronic
1144417423 17:15063991-15064013 ATGTGTATGTGGTGAGAAGGAGG + Intergenic
1145279820 17:21458745-21458767 GTGTGTGTGTGGCGGGGAGCAGG + Intergenic
1146560606 17:33865867-33865889 ATGTCTTGGTGGTAGGGAGCTGG - Intronic
1147053669 17:37817358-37817380 ATTGGTTTGTAGTGGGAATCAGG + Intergenic
1147865766 17:43551161-43551183 AAGAGTTTGAGGTGGGAGGCCGG + Intronic
1148492589 17:48032894-48032916 ATGTGTCTGGGCTGGGAAACTGG + Intronic
1148910299 17:50938961-50938983 CTATTTTTCTGGTGGGAAGCAGG - Intergenic
1149374121 17:56026911-56026933 ATATGTTGGTGGTGGCAAGGTGG + Intergenic
1150857442 17:68766652-68766674 ATGTGGTTGTGTTGGGAGGTGGG - Intergenic
1150927097 17:69544041-69544063 ATGTGATTCTGATGTGAAGCTGG + Intergenic
1151094309 17:71478581-71478603 ATGTGTGTGTGTTGGGGGGCGGG - Intergenic
1151959280 17:77396982-77397004 ATGTGGTTGTGGTGGGATTGGGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152303008 17:79506416-79506438 ATCTGTCTGTTGTGGGGAGCTGG + Intronic
1154493112 18:14936404-14936426 ATGCGTTTGTGGAGGGAGGGAGG - Intergenic
1155057126 18:22194712-22194734 ATGTGTGTGTGTTGGGAGGGGGG - Intronic
1155486127 18:26344978-26345000 ATGCGTTTGTGGTGGCAACAGGG - Intronic
1156085650 18:33398119-33398141 ATGTGTTTGTAGTGGAGAGAGGG + Intronic
1156129396 18:33952130-33952152 ATGTGTTTGTGGTGGGAAGCTGG + Intronic
1156310018 18:35913231-35913253 GTGTGTGTGTGGTGGGATGGGGG - Intergenic
1156597336 18:38562684-38562706 AGGTGTTAGTTGTGAGAAGCTGG - Intergenic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1157609572 18:48948137-48948159 ATGTATTTGTGCTGTGTAGCCGG - Intronic
1157827605 18:50826414-50826436 ATGGAGTTGTGGTGGGAAGCTGG - Intergenic
1159456799 18:68669471-68669493 ATGTGGTAATGGTGGGAGGCAGG + Intergenic
1159797614 18:72863804-72863826 GTGTGTGTGTGGGGGGAAGGTGG + Intronic
1160531180 18:79565651-79565673 TTGTGTGTGTGGTGGGGGGCGGG + Intergenic
1161890557 19:7033026-7033048 ATGTTTTTGTGGTGAGAAATTGG + Intergenic
1161892642 19:7051754-7051776 ATGTTTTTGTGGTGAGAAATTGG + Intergenic
1162240971 19:9354075-9354097 ATGTGTTTGTGGGGGGTAAGAGG + Intronic
1164473587 19:28555634-28555656 ATCCGTTTGGGATGGGAAGCGGG - Intergenic
1164723449 19:30449595-30449617 AAGTGTTGATGGTGGGAAGGGGG + Intronic
1164785122 19:30924381-30924403 GTGTGTTTGGGGTGGGGAGGAGG + Intergenic
1165485634 19:36093858-36093880 ATGTGTTTCTAGTGGGGAGACGG + Intronic
1165490869 19:36121895-36121917 GAGTGTTTGTGGAGGGAAGTGGG + Intronic
1165766777 19:38356559-38356581 ATGGGTCTGCGGTGGGAGGCTGG + Intronic
1165808767 19:38597604-38597626 GTGTGTATGTAGGGGGAAGCAGG + Intronic
1166133991 19:40764225-40764247 CAGTGTTTGTGGTGGGGAGTTGG + Intronic
1166516110 19:43448273-43448295 CTGTTTTTGAGGTGGGAGGCTGG + Intergenic
1166706923 19:44913164-44913186 ATGTAGTGATGGTGGGAAGCAGG + Intergenic
1166709097 19:44925719-44925741 ATGTGGTGATGGTGGGAAGCAGG + Intergenic
1166846900 19:45733873-45733895 CTCTGTTTGTGTTGGGAATCCGG + Intronic
1168193346 19:54755910-54755932 ATGGGCTTGTGGTGGGGATCTGG + Intronic
927352133 2:22128099-22128121 ATTTGTGTCTGGTGGGAAGGGGG - Intergenic
928624115 2:33122026-33122048 ATGTGTGTGTGGAGGGGGGCAGG - Intronic
930583957 2:53247927-53247949 CTGGGTTTGTGATGGGTAGCAGG - Intergenic
930858862 2:56049046-56049068 ATGTGCTTGTGGTGGGGAGGTGG - Intergenic
931135929 2:59400952-59400974 ATGTCTTTGTGTTGGGTATCAGG - Intergenic
932414598 2:71566001-71566023 GTGTGTGTGTGTTGGGCAGCAGG + Intronic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
932638864 2:73421014-73421036 GTGTGTGTGTGATGGGAAGGTGG - Intronic
933158622 2:79000547-79000569 GTGTATATGTGGTGGGAAGTGGG - Intergenic
933286185 2:80386984-80387006 ATGTGTTTATGGTAGGATGAGGG + Intronic
933492653 2:83007800-83007822 TTGTGTTTGTGGTGGAATACTGG + Intergenic
934055589 2:88248768-88248790 TTGTATTTGAGGTAGGAAGCGGG - Intergenic
935386503 2:102505032-102505054 AGGTGAATGTGGTGGGAAGGTGG - Intronic
935547099 2:104412116-104412138 TTGTGTTTTTGGTGGGGAGGCGG - Intergenic
935846390 2:107170199-107170221 ATATGCATGTGGTGGGAAGCGGG - Intergenic
936062043 2:109301296-109301318 GTGTGTATGTGGTGGGGGGCGGG + Intronic
936554292 2:113479924-113479946 ATGAGTCTGAGGTGGGAAGACGG - Intronic
936861391 2:117024845-117024867 TTATGTTTGGGGTGGGATGCTGG - Intergenic
937032404 2:118751820-118751842 ATCTGTATGTGGTGTGATGCTGG + Intergenic
937670616 2:124533734-124533756 CTTTGTTTGTAGTGGGAAGCAGG - Intronic
937862827 2:126724398-126724420 GTGTGTTTGTGGAGGAAAGGAGG - Intergenic
938120153 2:128627325-128627347 ATCTGTGTGTGTTGGGAAGCGGG + Intergenic
938835143 2:135094663-135094685 ATGGGTTAGAAGTGGGAAGCTGG - Intronic
940547888 2:155113774-155113796 TTGTTCTTTTGGTGGGAAGCAGG + Intergenic
941377363 2:164748023-164748045 AGCTGTGTGTGGTGGGGAGCAGG + Intronic
941551967 2:166927789-166927811 ATGTGTGTGTGGGGGGATGGAGG + Intronic
944402601 2:199345417-199345439 ATGAGTTTGTGGGGGGAGGGGGG - Intronic
945624030 2:212177970-212177992 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
945674832 2:212843571-212843593 ATGTATTTGTGTTGGGAGGAAGG - Intergenic
946443607 2:219718606-219718628 ATGTGTTACTATTGGGAAGCAGG + Intergenic
947360405 2:229340272-229340294 GTGTGTGTCTGGTGGGAGGCTGG - Intergenic
947544706 2:231002645-231002667 AAGTGGGGGTGGTGGGAAGCTGG - Intronic
947709818 2:232306560-232306582 CTGTGTTTGTGTTGGGAAGGAGG + Intronic
948132971 2:235614439-235614461 ATGTATTTGGGGAGGGAAGAAGG + Intronic
948776258 2:240290444-240290466 CTGTGCTTGTGGTGGGGAGGCGG - Intergenic
948825424 2:240571484-240571506 ATGTGGCTGTGGTTGGAAGAGGG + Intronic
1168910003 20:1440110-1440132 ATGTGTCTGGGGTAGGAAGCGGG - Intergenic
1168937737 20:1681420-1681442 GTGTGTGTGTGGTGGGGGGCAGG + Intergenic
1169027255 20:2381397-2381419 AAGTGCTTGGGGTGGGAATCAGG - Intronic
1169185602 20:3614338-3614360 AAGTGTGTGAGGTGGGAAGGTGG + Intronic
1169678996 20:8188137-8188159 ATGTGTTTGTTGTGGGGCCCAGG + Intronic
1169765656 20:9145163-9145185 ATGTTTTTGTGATGAGAAGCAGG + Intronic
1170026421 20:11893008-11893030 ATGTGTTTGGGCAGGGAAGTAGG - Intronic
1171343101 20:24445760-24445782 CTGTGTTTGTCGTGGGAGTCAGG + Intergenic
1171525223 20:25803833-25803855 ATGTGTTCGGGGAGGGAATCAGG + Intronic
1171551604 20:26052051-26052073 ATGTGTTCGGGGAGGGAATCAGG - Intergenic
1171792727 20:29543354-29543376 ATGTGTTCGGGGAGGGAACCAGG - Intergenic
1171855743 20:30341048-30341070 ATGTGTTCGGGGAGGGAACCAGG + Intergenic
1172397518 20:34619422-34619444 ATGATTTTTTGGTGGGAAACTGG + Intronic
1174130245 20:48339477-48339499 TTGTGTGTGTGGCGGGGAGCTGG - Intergenic
1174199793 20:48799339-48799361 ATGTCCTTGTGGTGGGCAGTGGG - Intronic
1175211237 20:57357426-57357448 CTATGTTTGGGGTGGGATGCTGG + Intronic
1176328956 21:5530030-5530052 ATGTGTTTCTTATAGGAAGCAGG + Intergenic
1176398801 21:6290921-6290943 ATGTGTTTCTTATAGGAAGCAGG - Intergenic
1176438356 21:6698183-6698205 ATGTGTTTCTTATAGGAAGCAGG + Intergenic
1176462618 21:7025253-7025275 ATGTGTTTCTTATAGGAAGCAGG + Intergenic
1176486179 21:7407031-7407053 ATGTGTTTCTTATAGGAAGCAGG + Intergenic
1179768988 21:43598832-43598854 CTGTGTTTGTGATCTGAAGCAGG - Intronic
1180948913 22:19712016-19712038 ATGTGTCTGTGGAGGGACTCGGG + Intergenic
1181546739 22:23606600-23606622 AAATATTTGGGGTGGGAAGCGGG + Intergenic
1181809021 22:25392302-25392324 ATGTGTTTTAGGTGGGAAACAGG - Intronic
1182458434 22:30467711-30467733 AGGTGTGTGTGGTGGGAACTAGG + Intronic
1182500457 22:30743094-30743116 ATGTGTTTGTCTGGGGAGGCAGG + Intronic
1182505805 22:30781489-30781511 GTGTGTTTGTGGAGAGACGCAGG + Intronic
1182666596 22:31964664-31964686 ATGTGTGTGTGGTGGGGTGAGGG + Intergenic
1183727582 22:39598054-39598076 CTGTGTGTGTGGTGGGTTGCGGG + Intronic
1183981124 22:41540923-41540945 ATGAGTTTGTGGAGGGGACCAGG + Intronic
949096094 3:87577-87599 TTGTGTGTGTGGGGGGACGCGGG + Intergenic
950472748 3:13196780-13196802 GTGTGTGTGTGGTGGGGAGCAGG + Intergenic
950752883 3:15144834-15144856 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
952093771 3:29923444-29923466 ATGTGTTGTTGGTGGGCAGATGG + Intronic
952155814 3:30642288-30642310 ATGTGTTTGTGGTGGTGGGGTGG + Intronic
952221841 3:31331427-31331449 ATTTCTTTGTGCTGGGGAGCGGG + Intergenic
952920928 3:38283359-38283381 ATGTGTGTGTGCTGGGAGGTGGG - Intronic
953182021 3:40604774-40604796 ATGTGTATGTGGGGGGATGGAGG - Intergenic
953611866 3:44453978-44454000 ATGTGTGTGAGATGGGAGGCAGG - Intronic
953699598 3:45185556-45185578 GTGTGTGTGTGGAAGGAAGCTGG + Intergenic
953774274 3:45802248-45802270 ATGTGTATGTGGTGCCAAGGAGG + Intergenic
954272827 3:49523025-49523047 ATGAGTTTGGGGTGACAAGCTGG - Intronic
955024439 3:55153912-55153934 ATGTGTTTGTGTGGGAAAGGTGG + Intergenic
955404894 3:58619861-58619883 ATGTGTGTGTGGTGGGGAGGTGG + Intronic
955747294 3:62152836-62152858 AAGTGTTGGGGGTGGGAAGTGGG - Intronic
956638443 3:71390565-71390587 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
956807227 3:72827533-72827555 AGGTGTTTTTGGTGGGGAGGGGG - Intronic
956909005 3:73797439-73797461 ATGTGTGGATGGTGGGAAACAGG - Intergenic
957072368 3:75577110-75577132 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
958593085 3:96185232-96185254 ATGTGTCTGTGTTGGGGGGCGGG + Intergenic
958899824 3:99872569-99872591 ATGTGTTTGTGGGGGCAGGCAGG - Intronic
959483170 3:106897950-106897972 GTGTGCTTGTGGTAGGAAGTAGG + Intergenic
960253835 3:115488975-115488997 ATGTGTATGTGTTGGGTGGCAGG + Intergenic
960692662 3:120363183-120363205 GTGTGTGTGTGGTGGGGAGGAGG + Intergenic
961285428 3:125798554-125798576 CTGTGTTTAAGGTGAGAAGCGGG + Intergenic
962214410 3:133508165-133508187 ATGTCTTTTTGCGGGGAAGCTGG + Intergenic
962403918 3:135083958-135083980 GTGTGTTTGTGGTGGCAGGATGG + Intronic
963192454 3:142487843-142487865 TTTTGTTTATGGTGGGAAGAAGG + Intronic
964487397 3:157199968-157199990 AGCTGATTGTGGTGGGAAGTGGG + Intergenic
964890070 3:161523947-161523969 ACATGTTTTTGGTGGGGAGCTGG + Intergenic
965381052 3:167988625-167988647 GTGTGTGTGTGGTGGGATGTGGG - Intergenic
966160805 3:176966332-176966354 TTATGTTTGGGGTGGGATGCTGG - Intergenic
966308328 3:178563369-178563391 TTGTTTCTGTGGTGGGTAGCTGG + Intronic
966317992 3:178670241-178670263 ATTTTTTGTTGGTGGGAAGCAGG + Intronic
966607496 3:181836061-181836083 ATGTGTATGTGGTGGGGGGGAGG - Intergenic
968051886 3:195660159-195660181 GTGTGTGTGTGGTGGGGAGTGGG + Intergenic
968319961 3:197757668-197757690 AGGAGTTTGAGGTGGGAAGATGG + Intronic
969438132 4:7200171-7200193 TTCGGTTTGGGGTGGGAAGCGGG + Intronic
969499995 4:7546824-7546846 ATGTGTTTTTGCAGGGAAGAGGG - Intronic
969737990 4:9003929-9003951 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
969797186 4:9535483-9535505 ATGTGTTTATGGTGGGGATGTGG + Intergenic
970089719 4:12391108-12391130 ATGTTTTTTTGGTGGGAAAAGGG + Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
970806853 4:20046575-20046597 ATGTCAGTGTGGTGGGGAGCAGG + Intergenic
971124568 4:23739308-23739330 ATGTGTATGTTGTGGGAAGGAGG - Intergenic
971153477 4:24058501-24058523 CTGGGTATGTGGTGGGAAGAGGG - Intergenic
971161448 4:24137867-24137889 CTGTGTTTGAGGGGGGAAACGGG - Intergenic
971337021 4:25732736-25732758 GTGTGTGTGTGGTGGGGAGTCGG + Intergenic
971846214 4:31922154-31922176 GTGTGTTTGTGGTGGGGAGCAGG - Intergenic
971938375 4:33183699-33183721 ATGAGATTGTGGGGAGAAGCAGG - Intergenic
972251805 4:37309687-37309709 AGGTGTCTGTGGTGGGAATGTGG + Intronic
972797997 4:42441656-42441678 ATGTGGGTGTGGTGGGATGTGGG - Intronic
976588077 4:86821008-86821030 ATGTGTTTTTGTTGGGACTCTGG - Intergenic
977964374 4:103126435-103126457 AGGTGTGTGTGGTGGGTGGCAGG - Intronic
979210869 4:118100393-118100415 ATGTGGTTGTGGAGGCAAGCTGG - Intronic
979546097 4:121941737-121941759 ATGTGTATGTGGTTGGAAGGAGG + Intronic
979601390 4:122589944-122589966 ATGTGTCTGTGTTGGGAGGTGGG - Intergenic
979611805 4:122697479-122697501 ATGTGATTTTGGTAGGCAGCTGG + Intergenic
981141882 4:141278445-141278467 TTTTTTTTGTGGTGGGGAGCGGG + Intergenic
981713934 4:147733985-147734007 ATGTGTGTTGGGTGGGAAGTAGG + Intronic
981719384 4:147786298-147786320 ATGTGTTTGTTTTGTGAATCTGG + Intronic
982443458 4:155462873-155462895 CTATGTTTGGGGTGGGATGCTGG + Intergenic
983063467 4:163183993-163184015 GTGTGTCTGAGGAGGGAAGCAGG - Intergenic
983498237 4:168469354-168469376 GTGTGTTTGTGGTGTGAATGGGG - Intronic
983520990 4:168708935-168708957 ATTTGTTTGTTGTGGAAAGGTGG + Intronic
983794183 4:171839539-171839561 ATGTGTGTGTGTTGGGAATGGGG - Intronic
984138308 4:175969805-175969827 AAGTGTGTGTGGAGGGATGCAGG + Intronic
984822856 4:183898254-183898276 ATGTGTGTGTGGGCTGAAGCAGG + Intronic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985364002 4:189207219-189207241 ATGTGTTTCTGTTGGAAAACTGG - Intergenic
985965571 5:3336775-3336797 AGGTGCATGTGGTGGGAAGTGGG + Intergenic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
986961006 5:13212679-13212701 ATGTGTACCTGGTGGTAAGCTGG - Intergenic
987276881 5:16372314-16372336 ATGTGGCTGGGGTGGGAAACAGG - Intergenic
987473305 5:18359430-18359452 ATGTGTGTGTGGTGGGGGGTTGG - Intergenic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
989807274 5:45624779-45624801 TTGTGTTTATGGAGGCAAGCAGG + Intronic
990864032 5:60360493-60360515 AGATGTGTGTGGTGGTAAGCTGG - Intronic
991528633 5:67591674-67591696 ATGTGTTTGGCGTGGGAGACAGG + Intergenic
991620921 5:68544869-68544891 ATGAATTTGTGGGTGGAAGCGGG + Intergenic
991919630 5:71642650-71642672 ATGTCTTTGTGCAGTGAAGCAGG + Intronic
992729509 5:79647073-79647095 ATATGGTTCTGTTGGGAAGCAGG - Intronic
992974110 5:82095207-82095229 AAGTCTGAGTGGTGGGAAGCTGG + Intronic
993139188 5:84008816-84008838 TTTTGTTTGTGGGGGGAAACAGG + Intronic
993484208 5:88462520-88462542 ATGTGGTAGAGGAGGGAAGCAGG + Intergenic
995507853 5:112879318-112879340 ATGTGTTTGGGGGGGGGGGCTGG + Intronic
996127206 5:119740206-119740228 AAGTGTTTGTGCTCCGAAGCTGG + Intergenic
996699596 5:126437045-126437067 ATGTTTTTGTGATGAGAAGGAGG + Intronic
997487752 5:134246101-134246123 TTGTCTTGGTGGTGGGAAGTTGG - Intergenic
997549527 5:134739507-134739529 ATGTGTTTGGGGGAGGAAGGAGG - Intronic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
998187514 5:139993114-139993136 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
999356970 5:150944417-150944439 ATGTGATTGTATTGGGAAGTGGG + Intergenic
999980100 5:156949777-156949799 TTGTGTTTGTGGTGGGTGGTGGG + Intronic
1000227856 5:159285185-159285207 GTGTGTGTGTGGTGGGAGGGTGG - Exonic
1000245769 5:159447281-159447303 ATGTGTTTGTGGAGGAAAGAAGG + Intergenic
1000297873 5:159927915-159927937 GTGTGTATTTCGTGGGAAGCAGG + Intronic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1000792421 5:165624206-165624228 TTGTGTCTGGGGTGGGGAGCAGG + Intergenic
1001783339 5:174389876-174389898 ATTTTTTTTGGGTGGGAAGCTGG - Intergenic
1001865510 5:175100884-175100906 ATGTGTGTGGGGTGGGGGGCGGG - Intergenic
1002131416 5:177084336-177084358 ATGTGGTTGTGGGGGGAGACAGG - Intergenic
1002257498 5:177968933-177968955 ATGTGGTGGTGGTGGGAGGTGGG - Intergenic
1002426912 5:179181978-179182000 GGGTGTGTGCGGTGGGAAGCTGG - Intronic
1002641501 5:180632792-180632814 GTGTGTATGTGGTGGGATCCCGG + Intronic
1003213119 6:4085665-4085687 AGGTGTTTTTGGTGGGGAGAAGG - Intronic
1004353704 6:14913050-14913072 ATCTGTTAGTGGGCGGAAGCGGG - Intergenic
1004811460 6:19268746-19268768 AAGTGTTTGTGGTGGCAATTGGG - Intergenic
1005445871 6:25922455-25922477 ATGTGAGTGTGCTGAGAAGCAGG + Intronic
1005919744 6:30390161-30390183 CTGTGTGTGTGGTGGGGGGCGGG + Intergenic
1006441805 6:34057950-34057972 ATGTGTGTGTGGTGGGTGGGTGG + Intronic
1006710583 6:36065749-36065771 ATGTGTTTGTGTGGGGAGGAAGG - Intronic
1007049692 6:38814744-38814766 ATGTGTTTGAGGTAGGGATCTGG - Intronic
1007496710 6:42264926-42264948 ATGGGTTTGTGGTGGGTATGAGG - Intronic
1007636198 6:43301289-43301311 ATATGTGTGTGGTGGGGAGTGGG + Intronic
1007947305 6:45838095-45838117 ATGTGTTAGGGGTGGGAATTAGG - Intergenic
1008130882 6:47719352-47719374 ATGTGTTAGTGCTGGGAAAACGG + Intronic
1008352572 6:50509903-50509925 ATGTGTTTGTATTGGGTAGGAGG + Intergenic
1008887815 6:56450159-56450181 ATGTGTAGGTGAGGGGAAGCAGG + Intergenic
1008936421 6:56997414-56997436 GTGTGTATGTGGTGGGGAGATGG - Intronic
1010364942 6:75040240-75040262 GTGTGTTTGTGGGGGGATGAAGG - Intergenic
1011914060 6:92480075-92480097 ATCTGTTTCTGATGGCAAGCAGG - Intergenic
1012547934 6:100440851-100440873 ATGTGTGTGTGGTGGGGGGTGGG - Intronic
1012931788 6:105325159-105325181 TTGTGTTTGTGGGGGGCACCGGG - Intronic
1013225512 6:108117600-108117622 ATGTGCGTGTGGTGCGAAGAGGG + Intronic
1013275631 6:108582260-108582282 ATGTGCTAGGTGTGGGAAGCAGG + Intronic
1013499914 6:110738953-110738975 ATGTTTCTGTGGTGAGAGGCAGG - Intronic
1013609969 6:111785481-111785503 GTTTGTGTGTGTTGGGAAGCGGG - Intronic
1013767903 6:113595494-113595516 ATGTGTTTGGGGTGGGGTGGGGG - Intergenic
1014461385 6:121699837-121699859 GTGTGTGTGTGGTGGGAATCAGG + Intergenic
1014479047 6:121912250-121912272 AGGTGTTTGTGGTGGTAATGGGG + Intergenic
1015169868 6:130240605-130240627 ATGTGACTGTGTTGGGAAGTGGG + Intronic
1015289454 6:131521512-131521534 CTGTGTTGGTGGTGTGAAGTGGG + Intergenic
1015419869 6:132994922-132994944 ATGTGTTTGTGGTAGAAAAACGG + Intergenic
1016050809 6:139528089-139528111 ATGTATGTGTGGGGGGAAGGAGG + Intergenic
1016632149 6:146245616-146245638 ATATGTTTGTGGTGGGAAAATGG - Intronic
1016726796 6:147380482-147380504 TTTTGTGTGTGGTGTGAAGCTGG - Intronic
1017198288 6:151725310-151725332 ATGTGGTTGTGGGGGGCAGGGGG + Intronic
1017336629 6:153268759-153268781 ATGAGTCTGTGGTGGGAATGTGG - Intergenic
1018831553 6:167447605-167447627 GTGGGTTTGTGATGGGATGCCGG + Intergenic
1019194729 6:170274509-170274531 AGGTGTGTGGGGTGGGGAGCAGG + Intergenic
1019629936 7:2043673-2043695 GGCTGTTTGTGGTGGGAAACAGG - Intronic
1020375674 7:7482919-7482941 GTGTTTGTGTGGTGGGAAGAAGG + Intronic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1021066438 7:16180222-16180244 ATTGGTTTGTGGTGGGACCCAGG + Intronic
1021277073 7:18664630-18664652 ATGTGTGAGGGGTGGGAAGCAGG - Intronic
1021691766 7:23237100-23237122 GTGTGTGTGTGTTGGGCAGCAGG - Intronic
1021940683 7:25676006-25676028 ATGTGTTTGTGGTGTGGTCCTGG + Intergenic
1022489364 7:30804960-30804982 ATGTGTGAGTGGTGGGAAGAGGG + Intronic
1023760260 7:43459089-43459111 ATATGTTTCAGGTGGGAGGCAGG - Intronic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1025731409 7:64111752-64111774 TTATGTTTGGGGTGGGATGCTGG + Intronic
1026046592 7:66909804-66909826 ATGCTTTTGTGGTGGGAATTGGG - Intergenic
1026275161 7:68870078-68870100 ATGGGTGGGTGGTGGGAAGGGGG + Intergenic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027684345 7:81264110-81264132 GTGGGTTGGTGGTGGGTAGCTGG + Intergenic
1027943586 7:84717081-84717103 ATGTGTGTGTGCTGCGAAGAAGG + Intergenic
1028281640 7:88937064-88937086 ATGTGTTTGGGGCAGAAAGCAGG - Intronic
1029153110 7:98495341-98495363 CTCTGTTTCTGATGGGAAGCTGG + Intergenic
1029221641 7:98995143-98995165 ACTTGTTTTTGGTGGGAAACAGG + Intronic
1029985665 7:104921023-104921045 ATGTGTGTGTGGTGGGGTGGGGG - Intergenic
1030272385 7:107684649-107684671 ATAGGTTTGGGGTGGGAACCAGG - Intronic
1030377621 7:108771506-108771528 ATCTGTGTTTAGTGGGAAGCAGG + Intergenic
1031962682 7:128004075-128004097 ATGTATTTGTGGGAGGAAGATGG + Intronic
1032260190 7:130329595-130329617 ATGTGGTTGTGTTTGGAAGCTGG - Intergenic
1032386555 7:131529580-131529602 ATGAGTTGGGGGTGGTAAGCAGG - Intronic
1034026373 7:147708630-147708652 ATGAGTTCATGGTGGGAACCTGG + Intronic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034725336 7:153330598-153330620 TTGTGTGTGTGTTGGGGAGCTGG + Intergenic
1035059865 7:156061605-156061627 ATGGGGTTGGGGTGGGAAGTGGG - Intergenic
1036257719 8:7218837-7218859 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036258969 8:7225834-7225856 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036307652 8:7613677-7613699 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1036309768 8:7677433-7677455 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036311022 8:7684430-7684452 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036358506 8:8061678-8061700 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1036359768 8:8068686-8068708 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1036829647 8:12011952-12011974 ATGTGTTTATGGTGGGGATGTGG - Intergenic
1036891192 8:12598284-12598306 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036892452 8:12605274-12605296 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036899997 8:12663252-12663274 ATGTGTTTATGGTGGGGATGTGG - Intergenic
1037810661 8:22084833-22084855 ATGTGTGTGTTGTGGGGAGGAGG - Intergenic
1037878727 8:22562190-22562212 ATGCGTTTGTGGTCAGCAGCAGG + Intronic
1038250837 8:25902903-25902925 ATGGGTGTGTGGTGAGCAGCAGG + Intronic
1039058676 8:33556461-33556483 GTGTGTGTGTGGTGGGCAGGGGG + Intronic
1039165170 8:34670933-34670955 ATGTGTGTGGTGGGGGAAGCAGG - Intergenic
1039448955 8:37655824-37655846 ATGTGTGAGGGGTGGGAAGTGGG + Intergenic
1039762322 8:40591041-40591063 ATCTGTTTGTGGTGAGGAGTGGG + Intronic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1040846690 8:51850440-51850462 ATCTGTTTGTGGTAGGACCCAGG - Intronic
1040948923 8:52916196-52916218 ATGAGTTTGCTGTGGAAAGCTGG + Intergenic
1041131846 8:54710017-54710039 ATGTTTTTGTGCTGGGATCCAGG + Intergenic
1041853594 8:62421891-62421913 GTCAGTATGTGGTGGGAAGCTGG + Intronic
1042670262 8:71254841-71254863 CTGTGTGTGTGGTGGGGGGCGGG - Intronic
1042864507 8:73345517-73345539 ATGTGTTAGGGGTGGGAGGAGGG - Intergenic
1044240468 8:89882464-89882486 ATGTGTTTGTATTGGGAGGAAGG - Intergenic
1044646492 8:94449189-94449211 GTGTGTGTGTGGTGGGGGGCGGG - Intronic
1044931981 8:97259968-97259990 ATGTGGTTGGGGTGAGACGCGGG + Intergenic
1045392185 8:101726380-101726402 AGGTGATGGTGGTGGGAACCAGG + Intronic
1046686633 8:117234939-117234961 ATGTGTTTGTAGTCGGATGTTGG - Intergenic
1047296246 8:123572833-123572855 ATGTGTTTGTGCTGTTAAGGTGG - Intergenic
1048287370 8:133152237-133152259 ATTTTTTTCTGGTGGGAAGAGGG - Intergenic
1048313928 8:133348363-133348385 ATGGGTTTGCTGTGTGAAGCTGG + Intergenic
1048707532 8:137170518-137170540 CACTGTTTGTGGTGTGAAGCAGG + Intergenic
1049021334 8:139959564-139959586 GGGTGTTGGTGGTGGGAAGGTGG - Intronic
1049898715 9:137254-137276 ATGAGTCTGAGGTGGGAAGACGG + Intronic
1050126958 9:2367483-2367505 AGGTGTTTGTGGTGGTAATGTGG - Intergenic
1050420034 9:5453808-5453830 ATGTCTTTGCTGTGGGAGGCTGG + Intronic
1050846846 9:10231807-10231829 ATGTGGTGGTATTGGGAAGCAGG + Intronic
1050869625 9:10550722-10550744 ATGTGCTTCAGGTGGGATGCTGG + Intronic
1051092905 9:13431154-13431176 GTGTGTGTGTGGTGTGTAGCGGG + Intergenic
1052495485 9:29218414-29218436 ATGAATTTGGGGTGGGAAGAAGG + Intergenic
1052760097 9:32581468-32581490 ATGTGGTAGTGGTGGGGAGTGGG - Intergenic
1053082125 9:35185019-35185041 ATATGTTTGAGGTGGGAGGAAGG - Intronic
1053210453 9:36222998-36223020 TTGTGTTTGTGGTGGAGCGCAGG - Exonic
1053741765 9:41147566-41147588 ATGAGTCTGAGGTGGGAAGATGG + Intronic
1053793563 9:41704341-41704363 ATGTGTTCGGGGAGGGAACCAGG + Intergenic
1054151615 9:61610489-61610511 ATGTGTTCGGGGAGGGAACCAGG - Intergenic
1054181974 9:61916356-61916378 ATGTGTTCGGGGAGGGAACCGGG + Intergenic
1054347029 9:63977376-63977398 ATGAGTCTGAGGTGGGAAGATGG + Intergenic
1054444759 9:65303713-65303735 ATGAGTCTGAGGTGGGAAGATGG + Intergenic
1054485512 9:65717790-65717812 ATGAGTCTGAGGTGGGAAGATGG - Intronic
1054686576 9:68283734-68283756 ATGAGTCTGAGGTGGGAAGATGG - Intronic
1056160064 9:83880863-83880885 ATAATTTTGTGTTGGGAAGCAGG - Intronic
1056360160 9:85848959-85848981 ATAATTTTGTGTTGGGAAGCAGG + Intergenic
1056418948 9:86404808-86404830 AAGTGTTTGTGAAGGGAAGATGG - Intergenic
1056753837 9:89370412-89370434 GTGTGTTTGTGGTGTGTGGCTGG + Intronic
1058617815 9:106852534-106852556 CTGTGTTTGTGTTTGGAGGCTGG - Intergenic
1058648059 9:107149050-107149072 TTCTGTTTGTGGTGATAAGCTGG + Intergenic
1058811202 9:108641259-108641281 ATGTGTTAGTGGGTGGAGGCAGG - Intergenic
1059516544 9:114901045-114901067 GTGTGTGTGTGGTGGGGAGGTGG + Intronic
1059757959 9:117311372-117311394 ATGTGCCTCTGGTGGGAAACAGG - Intronic
1059815959 9:117915398-117915420 ATGTGTGTGTGGTAGGTAGAGGG + Intergenic
1062388759 9:136325880-136325902 CTGGGTTAGTGGTGGGAGGCTGG - Intergenic
1185622987 X:1464788-1464810 GTGTGTGTGTGGGGGGAAGTGGG + Exonic
1186068828 X:5795542-5795564 ATGTGTTTGTGGAAGCAAGGAGG - Intergenic
1186376959 X:9014031-9014053 ATGTGTGTGTGGGGGGGAGGAGG - Intergenic
1186636594 X:11412309-11412331 TTTTGTTTTTGGTGGGAGGCTGG - Intronic
1186730412 X:12403555-12403577 GTGGGTTTGTGGTGGGCGGCGGG - Intronic
1187791058 X:22950857-22950879 ATGTGCTTGTGGTAACAAGCTGG - Intergenic
1187940504 X:24376178-24376200 GTGTGTGTGTGGTGGGGAGTGGG + Intergenic
1187955064 X:24509477-24509499 ATGTGTGTGTTGGGGGAAGAGGG - Intronic
1189754794 X:44260107-44260129 AGTTGTCTGTGGTGGGGAGCGGG + Intronic
1192553720 X:72073435-72073457 ATCTGTATGTGGTGGGGAGGGGG + Intergenic
1192656792 X:73002107-73002129 ATGTGTTGGAGGTGTGGAGCAGG - Intergenic
1192665328 X:73080894-73080916 ATGTGTTGGAGGTGTGGAGCAGG + Intergenic
1192782168 X:74305235-74305257 ATGTGTATGTGGGGGAAAGAGGG + Intergenic
1193598851 X:83483287-83483309 ATGTGTTTGTGGAGGTATGAGGG + Intergenic
1194933019 X:99912229-99912251 ATGTGTGTGTAGTGGCAGGCAGG - Intergenic
1194972202 X:100356483-100356505 ATGTGTTGGGGGTAGGAAGTAGG - Intronic
1195459590 X:105108979-105109001 ATATGTTTGTAGAGTGAAGCGGG - Intronic
1195881260 X:109594885-109594907 GTGTGTCTGTGGTAGGAGGCAGG - Intergenic
1197882992 X:131188926-131188948 GTGTGTTTGTGGTGGGGTGTGGG + Intergenic
1198316449 X:135471525-135471547 ATATGTTCATGGTGGGAAGAAGG - Intergenic
1198972114 X:142293437-142293459 ATGTGTGTGTGGGGGGGGGCCGG + Intergenic
1199217695 X:145279860-145279882 GTGTGTTTTTTGTGGGAAACGGG + Intergenic