ID: 1156129814

View in Genome Browser
Species Human (GRCh38)
Location 18:33957674-33957696
Sequence TTAAAGACTTTCTAAATGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 336}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156129812_1156129814 1 Left 1156129812 18:33957650-33957672 CCAGAAATTTTAAGCAAACACTC 0: 1
1: 0
2: 1
3: 21
4: 228
Right 1156129814 18:33957674-33957696 TTAAAGACTTTCTAAATGGTTGG 0: 1
1: 0
2: 1
3: 28
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156129814 Original CRISPR TTAAAGACTTTCTAAATGGT TGG Intronic
901370266 1:8791278-8791300 TTAATGACTCTCTACATTGTTGG + Intronic
901484176 1:9546936-9546958 CTGAAGACTTGCTTAATGGTGGG - Intronic
903088600 1:20887913-20887935 TTAATAACTTACTAAATGGTTGG + Intronic
904529834 1:31161087-31161109 TTGAAGACCATCTTAATGGTGGG - Intergenic
905232951 1:36526583-36526605 TTAAAGACTTTTTAAATCTGTGG - Intergenic
906958210 1:50395067-50395089 TTAAACACCTTCTAAATTCTAGG + Intergenic
908363926 1:63398045-63398067 TTATTGACTTACTAGATGGTTGG + Intronic
908982657 1:69977438-69977460 TTAAACATTTTCTAAGTGCTAGG - Intronic
909431723 1:75595733-75595755 TTAAACACTTTCTAAGTGCTAGG + Intronic
909737962 1:78989788-78989810 TTAAAGCCTTTCTATATGGCTGG + Intronic
910694993 1:90002969-90002991 TTAAAGGCTTTCTGAAAGGTTGG - Intronic
911502179 1:98701101-98701123 TTAAAGACATTGTAAAAGTTCGG + Intronic
911567596 1:99481972-99481994 TTGAAGACCTTCTATATGATGGG + Intergenic
912182121 1:107231883-107231905 CTTGAGACTTTCTAAATGGAGGG - Intronic
914044935 1:144083562-144083584 TTAAAGATTTCCTAAATTTTTGG + Intergenic
914133175 1:144877124-144877146 TTAAAGATTTCCTAAATTTTTGG - Intergenic
914407198 1:147388427-147388449 TAAAATACTTTCTAAATTTTTGG + Intergenic
915153572 1:153855597-153855619 TTAATGACTTTCTGAATGAAAGG - Intronic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
918896085 1:190348269-190348291 CTGAAGACTTTATAAATGTTTGG + Intronic
919400355 1:197108129-197108151 TTATTTACTTTCTAAATGTTTGG - Intronic
919509602 1:198445601-198445623 TCTAATACTTTCTAAATGATAGG + Intergenic
920891895 1:209994966-209994988 TTAAAGACTTCTTATATGGCTGG - Intronic
920930378 1:210382484-210382506 TTAAAGGCTTGCTGAATGTTGGG + Intronic
922076091 1:222246261-222246283 TTAAAGACTTTCTAGCTCTTGGG + Intergenic
923560052 1:235032350-235032372 ATAAAGACATTCTCAATGGAAGG + Intergenic
924413960 1:243837970-243837992 TTAAAGATTTTCTACATAGATGG - Intronic
1063811333 10:9712379-9712401 CTAAAAACTTTCCAAATAGTGGG - Intergenic
1064689252 10:17897146-17897168 TGAAAAAGTTTTTAAATGGTTGG - Intronic
1065159337 10:22902976-22902998 TTACAGTCTTTCTTCATGGTTGG + Intergenic
1066604831 10:37154132-37154154 TTAATGTCTTTCTCACTGGTGGG + Intronic
1066606370 10:37178226-37178248 TTAATGTCTTTCTCACTGGTGGG + Intronic
1066607906 10:37201791-37201813 TTAATGTCTTTCTCACTGGTGGG + Intronic
1066628113 10:37430468-37430490 TTAAAGTGGTTCTAAAAGGTGGG - Intergenic
1067317459 10:45181488-45181510 TTAGAGACTTTCTGAAAGGCTGG + Intergenic
1067486783 10:46658180-46658202 TTTAAGAATTACTAAATGTTGGG + Intergenic
1067607967 10:47683485-47683507 TTTAAGAATTACTAAATGCTGGG - Intergenic
1069621872 10:69842311-69842333 TTAACAAGGTTCTAAATGGTTGG - Intronic
1070291464 10:75118239-75118261 CTAAAGAGTTTCAAAATGGATGG + Intronic
1070626850 10:78057051-78057073 TTAAAGATTTTCTATGTGGTGGG + Intergenic
1070667366 10:78354685-78354707 TTAAAGATCTTCTAAGTGGCAGG - Intergenic
1071017067 10:81010114-81010136 TTCAAGTCTTTATAAATGATAGG - Intergenic
1071275793 10:84053733-84053755 TCAGAGCCTTTCTAAATGATTGG - Intergenic
1071358510 10:84821802-84821824 TGAAAGACTTTGTAAATGACTGG + Intergenic
1071623570 10:87145198-87145220 TTTAAGAATTACTAAATGCTGGG - Intronic
1072258060 10:93639818-93639840 TTAAAGACTTTCTAAGTGATGGG - Intronic
1073172990 10:101528404-101528426 TTTGAGCCTTTCTAAAGGGTAGG + Intronic
1073727183 10:106247007-106247029 TTAAATACTTAATAATTGGTAGG - Intergenic
1075365658 10:121885929-121885951 TTAAAAAGTTTCAAAATGTTCGG + Intronic
1077463171 11:2721073-2721095 GTAAAGAGTTTCTAAAAGGTGGG + Intronic
1077845824 11:6023748-6023770 TTAAAGGCATTTTAAATGGATGG - Intergenic
1078261163 11:9710272-9710294 TTGAAGACTTACTATATGCTAGG - Intronic
1080227329 11:29975430-29975452 TTGAAGACTTTTTTAATGTTGGG - Intergenic
1081208417 11:40302002-40302024 ATAAAGACTTTCAAAATGGAAGG + Intronic
1082736014 11:56856526-56856548 TAAAAGACTTTCTAAAAGGAAGG - Intergenic
1084246503 11:67861156-67861178 TTAAATACTTTCTAAAGGCAAGG + Intergenic
1086439916 11:86818459-86818481 GAAAGGTCTTTCTAAATGGTCGG - Intronic
1086562766 11:88187253-88187275 TTAAATACTTCTTATATGGTGGG - Intergenic
1086582841 11:88419041-88419063 ATAAATGCTTTCCAAATGGTGGG + Intergenic
1087167449 11:95019613-95019635 TAAAAAACTTTCTTAAGGGTGGG + Intergenic
1088560373 11:111109287-111109309 TTAAACACTTTATTATTGGTAGG - Intergenic
1089293431 11:117452542-117452564 ATAAAGACTGTCAGAATGGTAGG - Intronic
1089654091 11:119934523-119934545 TTACAGAGTTACTAAATGGGAGG - Intergenic
1090009128 11:123030403-123030425 TTAAACCCTTTTTAAATGGGGGG + Intergenic
1090528692 11:127565655-127565677 TTAAAAAGATTCTAAGTGGTGGG - Intergenic
1092417067 12:8298279-8298301 TTAAATACTTTCTAAAGGCAAGG + Intergenic
1092751503 12:11723793-11723815 ATAAAAGCTTTCTCAATGGTTGG - Intronic
1094546163 12:31406379-31406401 TAAAAGACTTTCTTTATGTTAGG + Intronic
1095740674 12:45603411-45603433 ATAAATACTTTCTAAATATTGGG + Intergenic
1098717787 12:73853778-73853800 TTAAGTACTTTATAAATGTTAGG - Intergenic
1098728216 12:73996928-73996950 GCAAAGACTTTCTCAGTGGTGGG - Intergenic
1099396024 12:82140178-82140200 GAAAAGACTTTTTAAATGGGGGG + Intergenic
1099499209 12:83390213-83390235 TTAAAGATTTAATAAAAGGTAGG - Intergenic
1101497602 12:105270149-105270171 ATAAACAATTTTTAAATGGTAGG - Intronic
1102189559 12:110976723-110976745 TTGAATATTTTCTCAATGGTTGG + Intergenic
1102774028 12:115503191-115503213 TTAAAGTGTTGGTAAATGGTTGG - Intergenic
1106003573 13:25747978-25748000 TTATAGATTTTCTGAATGATTGG - Intronic
1106975915 13:35214420-35214442 TTTAAGACTTTATAATGGGTGGG + Intronic
1107887015 13:44882071-44882093 TCAAAGACTGTCTTCATGGTAGG - Intergenic
1108248760 13:48544032-48544054 TTAATGACCTTTTAAATGGCTGG + Intergenic
1108563162 13:51666802-51666824 TTAAAGCCATTTCAAATGGTAGG + Intronic
1108636506 13:52340265-52340287 TTTAAGACTTACTAAAGGCTGGG - Intergenic
1111611077 13:90607722-90607744 TTTAAAACTTTCTAAGAGGTGGG + Intergenic
1111732414 13:92093728-92093750 TTAATGACTTTCTCAATTGTTGG - Intronic
1115039193 14:28900476-28900498 TTAAAGTATTTGTAAATGGTTGG - Intergenic
1115737151 14:36345265-36345287 TTAAAGATTTTGTAAGTGTTTGG + Intergenic
1116211759 14:41955306-41955328 ATAAAGACTTTCTATCAGGTTGG - Intergenic
1116455982 14:45121431-45121453 TTAAAGAGATTCTAAATACTTGG - Intronic
1118848316 14:69565087-69565109 TTTAAGACTTCTTAAATGATGGG - Intergenic
1119011351 14:70992976-70992998 TTAAAGATTTTCTAAAATGATGG - Intronic
1119011485 14:70994963-70994985 TTAAAGATTTTCTAAAATGATGG + Intronic
1119464254 14:74842092-74842114 TTAAACACTTACTACTTGGTTGG + Intronic
1120381737 14:83789395-83789417 TTAAAGATTTTTTAACTGGAAGG + Intergenic
1120404376 14:84076220-84076242 TTAAATATTTTCTGGATGGTGGG - Intergenic
1120719506 14:87875496-87875518 TTAAGCAGTTTCTAAATGTTAGG - Intronic
1121002210 14:90459902-90459924 TTAAATACTTTCATACTGGTTGG - Intergenic
1121753373 14:96378657-96378679 TTAAGCACTTTCTACATGGCAGG + Intronic
1122395044 14:101420304-101420326 TTAAAGTATTTTTATATGGTTGG - Intergenic
1122683240 14:103483469-103483491 TTAAAGGCTTACTAAATGCAAGG + Intronic
1122949975 14:105038049-105038071 TTAAAAACTTCCTAAAAAGTTGG + Intergenic
1202936048 14_KI270725v1_random:88532-88554 TTAAAGATTTCCTAAATTTTTGG - Intergenic
1123671127 15:22659208-22659230 TTAATGACTTTGTCAATTGTTGG - Intergenic
1124527063 15:30465581-30465603 TTAATGACTTTGTCAATTGTTGG - Intergenic
1124771590 15:32542102-32542124 TTAATGACTTTGTCAATTGTTGG + Intergenic
1125526080 15:40375757-40375779 ATGAAGACTTTCTAGAAGGTAGG + Intergenic
1126143912 15:45459262-45459284 TGGTAGACTTTCAAAATGGTAGG + Intergenic
1126151868 15:45530620-45530642 TGAGAGACTAGCTAAATGGTTGG - Intergenic
1126952957 15:53902621-53902643 TTAAACACTTTCTACATGCAAGG + Intergenic
1127592966 15:60445562-60445584 CTAAAGACTGTCTAAATAGAAGG - Intronic
1127593385 15:60451474-60451496 TTAAAAACATTCCAAATTGTTGG + Intronic
1128285363 15:66432211-66432233 GTAAAGACTTTCCTAATGGCAGG - Intronic
1128524048 15:68398910-68398932 TTAAAAACTGAATAAATGGTAGG + Intronic
1128809002 15:70556346-70556368 TTAAATGCTTTCTTAATTGTAGG + Intergenic
1128873855 15:71185972-71185994 TTAAACACTTTCTGTATGTTGGG + Intronic
1131597181 15:93810050-93810072 CTAAAGACTTTCTAACTGCTAGG + Intergenic
1132902621 16:2266557-2266579 TTAAAGACTCGATAAATGTTAGG + Intronic
1133466952 16:6036504-6036526 TTAAAAACTATCTAAGTGATAGG - Intronic
1133662913 16:7936221-7936243 TTAAAGACTTTTTAAAAAATTGG - Intergenic
1134187243 16:12094312-12094334 TTAAAGACTGAATAACTGGTAGG + Intronic
1137443852 16:48520002-48520024 TTAAAAATTTTTTAAATGCTGGG + Intergenic
1137598356 16:49739637-49739659 GTAAAGACTTTGGAAATGGTAGG - Intronic
1137641532 16:50035008-50035030 TTAATGACTTTTTAAATTGAAGG - Intronic
1140175827 16:72658704-72658726 TTAAAGACATTCTCTCTGGTGGG - Intergenic
1141083527 16:81075183-81075205 AAAAAGACTATCTAAATGGATGG - Intronic
1143604435 17:7973864-7973886 TTAAAGACTTTTTATATTTTTGG - Intergenic
1146771172 17:35569880-35569902 GGAAAGACTTTCTAGATGGAGGG + Intergenic
1148369536 17:47086935-47086957 TTAAATACTTGTTAAATGGAAGG - Intergenic
1149226914 17:54482531-54482553 TTAAAGAACTTCTGAATAGTAGG - Intergenic
1149354057 17:55821575-55821597 TTTAGCACTTTCTAAATGCTAGG + Intronic
1149942910 17:60889936-60889958 TTTAAGAATTTATAAATGTTTGG + Intronic
1150180856 17:63119405-63119427 TTAAAGGCTTTCTAAACATTGGG - Intronic
1150508238 17:65720917-65720939 TCACATAGTTTCTAAATGGTGGG + Intronic
1150530829 17:65979541-65979563 TTAGGCTCTTTCTAAATGGTAGG + Intronic
1150832139 17:68532708-68532730 TTATAGATTGTCTTAATGGTAGG + Exonic
1150963484 17:69940303-69940325 CTAGAGACTTTTTAAATTGTTGG + Intergenic
1153375111 18:4368041-4368063 TTAATGACCTTCAAAATGATGGG + Intronic
1153450587 18:5223522-5223544 TTAAAGACTATCTAAATAAATGG + Intergenic
1155607270 18:27621141-27621163 TCAAAGACTTTTTAAATGTCAGG + Intergenic
1156129814 18:33957674-33957696 TTAAAGACTTTCTAAATGGTTGG + Intronic
1157244294 18:46039946-46039968 TTGAAGACTTTCTAAAAGAAAGG - Exonic
1157259975 18:46169203-46169225 TTACAGACTTTCTAAATAGATGG + Intergenic
1157709469 18:49840188-49840210 TTATACACATTCTAAATGGGAGG - Intronic
1157951908 18:52048418-52048440 TATAAGACTTTCTAAATTATAGG + Intergenic
1158097310 18:53788559-53788581 TTAATGAATTTCTAAATGTTTGG - Intergenic
1159247418 18:65826542-65826564 TGAAAGACTTTGTAAAAGTTTGG - Intronic
1164330659 19:24251611-24251633 TTAATGATTTTCAAAATGGGAGG - Intergenic
1164380448 19:27733179-27733201 TTAAATGCTTTGTAAATTGTGGG - Intergenic
1202684493 1_KI270712v1_random:36966-36988 TTAAAGATTTCCTAAATTTTTGG + Intergenic
927387056 2:22546867-22546889 TAACAGACTTTCCAAATTGTCGG - Intergenic
927529063 2:23776853-23776875 TTGATGACTTTCTATATAGTAGG + Intronic
928167841 2:28983645-28983667 TGCAAGACTTTCTCAAGGGTGGG + Intronic
928790529 2:34946470-34946492 TTATAGACTTTTTTAATGATGGG + Intergenic
928828694 2:35452104-35452126 ATAAAGACTTTTTAAATAATTGG + Intergenic
930405666 2:50952504-50952526 TTAATAACTTGCTACATGGTAGG + Intronic
931545629 2:63382482-63382504 TTAAATCTTTTCAAAATGGTAGG + Intronic
932832125 2:75000282-75000304 TTAAAAACTTTTTAGAGGGTGGG + Intergenic
934247226 2:90317880-90317902 TTAAAGATTTCCTAAATTTTTGG - Intergenic
934262101 2:91484723-91484745 TTAAAGATTTCCTAAATTTTTGG + Intergenic
934305150 2:91815709-91815731 TTAAAGATTTCCTAAATTTTTGG + Intergenic
934328107 2:92037039-92037061 TTAAAGATTTCCTAAATTTTTGG - Intergenic
934466493 2:94267578-94267600 TTAAAGATTTCCTAAATTTTTGG - Intergenic
938826144 2:135007188-135007210 TTAATGACTGTATAAATGGAGGG - Intronic
940182041 2:150945174-150945196 TAGAGGACTTTTTAAATGGTGGG + Intergenic
940367253 2:152861844-152861866 TTGAAGACTTTCTTAGTGCTAGG + Intergenic
941135458 2:161711969-161711991 TTATAGACATTCTAAGAGGTTGG + Intronic
941154127 2:161954589-161954611 TTAAAGACATTTTAAATGAAAGG + Intronic
941324708 2:164099396-164099418 TTAAAGTCTTTCCACATGCTTGG + Intergenic
941335002 2:164231075-164231097 TTAAATACTCATTAAATGGTAGG + Intergenic
942137696 2:172944337-172944359 CTTAGGACTTTCAAAATGGTGGG - Intronic
942203788 2:173599427-173599449 TTAAACAATTTTTAAATTGTTGG + Intergenic
942797406 2:179838027-179838049 TTAAAGAATTAATAAATTGTAGG - Intronic
943613870 2:190068739-190068761 TTATAGACTTTCTAAGTGAAAGG + Intronic
944031388 2:195239012-195239034 TTAAAGAGTTTCCAGATGCTTGG + Intergenic
944081817 2:195796577-195796599 TCACAGACTTTCTCAAGGGTTGG + Exonic
944509964 2:200454823-200454845 CTAAAAGTTTTCTAAATGGTTGG - Intronic
946793884 2:223329383-223329405 TGACATACTTTCTCAATGGTTGG + Intergenic
946826363 2:223682442-223682464 TAAAATATTTTTTAAATGGTGGG + Intergenic
946990540 2:225324443-225324465 TCAAAGAATTTGTAAATGATTGG - Intergenic
947222574 2:227807678-227807700 TTTAAAACTTTCTAAAATGTGGG - Intergenic
947286224 2:228517970-228517992 TTGAAGACTTGCTATATGCTAGG - Intergenic
948245286 2:236477797-236477819 TTAAAGGCTTTCCAAATTGTTGG + Intronic
948431972 2:237924646-237924668 TTAAAGATTATCTGAATGGTTGG - Intergenic
1168749948 20:275420-275442 TTAAAGAATTTGCAAATGCTAGG + Intronic
1171151799 20:22834246-22834268 TTAAAGACTTTTTAAATAATAGG - Intergenic
1173340253 20:42146853-42146875 TTAAACACCTTATAACTGGTAGG - Intronic
1174763917 20:53233915-53233937 TTAAAAACTTTTTAAATGTCTGG + Intronic
1175025253 20:55894937-55894959 TTACAGAGTTTCTAAATTGTAGG - Intergenic
1175489816 20:59372279-59372301 TTAAGGACTTTCTAAAGTGGGGG + Intergenic
1175512426 20:59539884-59539906 TTACAGATTTTCCAAATTGTTGG + Intergenic
1176982125 21:15394988-15395010 ATAAAGACTTACCAAATGGAAGG + Intergenic
1177402247 21:20620903-20620925 TTCAGGACTATCTAAATAGTTGG + Intergenic
1177487230 21:21775506-21775528 TTAAATACTTTATAAATCATGGG + Intergenic
1179215570 21:39364356-39364378 TTGAATACTTTCAAAATGTTTGG + Intergenic
1180280397 22:10688212-10688234 TTAAAGATTTCCTAAATTTTTGG - Intergenic
1181718915 22:24758394-24758416 TTATAGATTTTTTAAATGATTGG - Intronic
1182793163 22:32970118-32970140 TTAAGCACTTTCTATATGCTAGG + Intronic
1184126411 22:42490536-42490558 TTTAAGACTTGCTCAGTGGTTGG - Intergenic
949309793 3:2684218-2684240 TTGAAGCCTTGCTAAATGATTGG - Intronic
949380646 3:3441645-3441667 TTAAATACATTCTTAATGTTAGG - Intergenic
950825094 3:15810525-15810547 TTAAAGAATTTCTAAAACATGGG + Intronic
951095320 3:18622797-18622819 TAAAAAATTATCTAAATGGTCGG + Intergenic
952132052 3:30375462-30375484 TTAAATATTTTCTAAATAATGGG + Intergenic
952721087 3:36533385-36533407 TCAAAGACTTTCCAAATTTTTGG - Intronic
953212481 3:40888342-40888364 TTCAAGACTTTCTTAATGTTTGG - Intergenic
954507264 3:51089166-51089188 TTAAGAACTTTCTATATGCTGGG - Intronic
954857170 3:53654592-53654614 TAAAATACTTTGTCAATGGTGGG - Intronic
956137705 3:66115355-66115377 TTACATACTTTCTATATGGTGGG - Intergenic
957742734 3:84293313-84293335 TTGAATACTTTCTGAATGGAAGG + Intergenic
957764784 3:84609360-84609382 ATAAAGAATATCAAAATGGTTGG + Intergenic
961245642 3:125450649-125450671 TGGAAGACTTTCTAAAACGTTGG - Intronic
961894616 3:130156882-130156904 TTAAATACTTTCTAAAGGCAAGG + Intergenic
962460079 3:135603530-135603552 TTAATGCCTTTGCAAATGGTTGG - Intergenic
964713805 3:159700054-159700076 TAGAAAAGTTTCTAAATGGTGGG - Intronic
966041287 3:175491685-175491707 AACAAGACTTTCTAACTGGTAGG + Intronic
967549846 3:190779354-190779376 TTAAAAACTTTCAAACTTGTTGG - Intergenic
969748158 4:9090191-9090213 TTAAATACTTTCTAAAGGCAAGG - Intergenic
970001685 4:11371392-11371414 TTAAAGACTCGATAAATGTTAGG - Intergenic
970034613 4:11718859-11718881 GTAAAGACTTTCTAAGTCTTGGG - Intergenic
971583327 4:28371804-28371826 TTAAAGACTTACAAAATGTAAGG + Intronic
971591564 4:28475230-28475252 TTAAAGATTTTTTAAAAGTTGGG - Intergenic
971904047 4:32702940-32702962 TGGAAGAGTTTCTAAGTGGTTGG - Intergenic
973928123 4:55760716-55760738 TAAAATATTTTTTAAATGGTGGG + Intergenic
974616519 4:64290707-64290729 TTCAACACTTTCTAAATTTTAGG + Intronic
974623981 4:64398810-64398832 TTAAAGACTGATTAAATGATTGG + Intronic
975499837 4:75072590-75072612 TCAAATACTGACTAAATGGTAGG - Intergenic
976080515 4:81350066-81350088 TTAAGGACTTACTATATGATTGG - Intergenic
976957963 4:90927583-90927605 TAACACACTTTCCAAATGGTGGG + Intronic
977367272 4:96086264-96086286 TTATAGACTATGTAAATGTTTGG - Intergenic
977692865 4:99935626-99935648 TTGAATATTTTCTAAATGGTGGG + Intronic
978979137 4:114919989-114920011 TAAATGACTTTCTAGAGGGTAGG - Intronic
979016521 4:115441443-115441465 TTAGGGACTTTCAAAAGGGTAGG + Intergenic
979100355 4:116604494-116604516 TTAAATACTTTCTCCATGGGTGG + Intergenic
979234240 4:118381675-118381697 TTAGAAACATGCTAAATGGTTGG + Intergenic
979380591 4:120001781-120001803 TTAAAGGCTTGCTCAATGTTTGG - Intergenic
980509260 4:133763181-133763203 ATAAAGAATTTCTAAATGCATGG + Intergenic
980511943 4:133803678-133803700 TTAAAAAGTTTCTAAATCATAGG + Intergenic
982377166 4:154705662-154705684 TTAAAGACTTTTTTTATTGTTGG + Intronic
983146181 4:164217673-164217695 TAACAGACCTTATAAATGGTTGG - Intronic
983591725 4:169420195-169420217 TTGAAGACTTTCTAGATTGGAGG - Intronic
984590323 4:181609970-181609992 TAAAACACTTTCTAAATGATAGG - Intergenic
984645750 4:182218023-182218045 TTTAACACTTTCTATATGTTAGG + Intronic
984993753 4:185407589-185407611 TTTAAGACTTTTTAAAAGATTGG + Intronic
985254053 4:188052409-188052431 TTAAAGACTTACCAAAGGCTGGG + Intergenic
986858164 5:11895834-11895856 TTAAATATTTTCTAATTTGTTGG - Intronic
987877734 5:23701101-23701123 TTAAAGACTTTGTAAGTTGATGG + Intergenic
987946518 5:24616361-24616383 TTAAAGAATTTTTACATTGTAGG + Intronic
988928173 5:36010001-36010023 CTAGAGACTTGTTAAATGGTTGG - Intergenic
990090217 5:52036160-52036182 TTTAAAATTTTCTAAATTGTGGG + Intronic
991711242 5:69411112-69411134 TTAAAGATTTTAAAAATGGCCGG + Intronic
992167744 5:74071514-74071536 TTTAAGACTTTCTTATTTGTAGG + Intergenic
992390864 5:76329614-76329636 GCAGAGACTTTCTAAATGCTGGG + Exonic
992445295 5:76827891-76827913 TTAAAGAGTTCCTATATGGCTGG - Intronic
992697069 5:79300112-79300134 TTAAAAAATTTCTAGCTGGTGGG - Intronic
992938422 5:81736989-81737011 TTAAAAACTTTCTGAATTGTAGG - Intronic
993014022 5:82515377-82515399 TCAAAGACTTTCTGAATTGGCGG - Intergenic
993237082 5:85325316-85325338 TTAAAGCACTTCTAAATGGATGG - Intergenic
993639826 5:90389016-90389038 TTAAGGAGGTCCTAAATGGTAGG + Intergenic
993838575 5:92847117-92847139 TTAGGAACTTTCTAAATGGAGGG - Intergenic
994603065 5:101932574-101932596 GTAAATACATTGTAAATGGTGGG + Intergenic
994869098 5:105320994-105321016 TTAGACACTTTCCAAAAGGTTGG + Intergenic
994911744 5:105918643-105918665 ATAAAGAAATTTTAAATGGTGGG - Intergenic
995640183 5:114247514-114247536 CTAAAGACTTTTTAAATGAAAGG + Intergenic
995963867 5:117880318-117880340 TTAAGGACTTTCACAATAGTTGG - Intergenic
996674395 5:126157542-126157564 TTAGAGACTGTTTAAATGGTTGG + Intergenic
997019168 5:129976666-129976688 TTATATATTTTTTAAATGGTGGG + Intronic
997190242 5:131926609-131926631 TTAAATACTCTTTAAATGTTTGG + Intronic
998754615 5:145362560-145362582 ATAAATATTTTCTAAATGGCTGG + Intergenic
999016348 5:148110502-148110524 TAAAATACTTTTTAAATTGTTGG - Intronic
1001772665 5:174307883-174307905 TTGAATTCTTTCTAATTGGTTGG + Intergenic
1002611652 5:180422987-180423009 TTAAAGACTATCTAAATAAATGG - Intergenic
1003483036 6:6550552-6550574 TTCTAGACTTTCTAATTGCTGGG + Intergenic
1005023862 6:21444257-21444279 TTGAATATTTTCTAAATGATAGG + Intergenic
1006666255 6:35696210-35696232 TTAAAGACCATCTAAATAATTGG + Intronic
1007343732 6:41210487-41210509 TTAAAGACTTTTTAATTTGGGGG + Intergenic
1007916275 6:45564714-45564736 TCAAAGACTTTCTGAATGTGAGG + Intronic
1007942260 6:45792812-45792834 TTAAAGACAATCTAAATGAATGG + Intergenic
1008205689 6:48653769-48653791 TTAAAGATTCTCTGAATGGCAGG - Intergenic
1010448615 6:75977246-75977268 TTACAGTCTTTCTAATTGCTAGG + Intronic
1010725970 6:79333715-79333737 TTAAACAATTACTAAGTGGTAGG - Intergenic
1011081442 6:83494203-83494225 TTAAAGACTATCTAAATAAATGG - Intergenic
1011859925 6:91741797-91741819 TTAAACACTTACTACATGCTTGG - Intergenic
1012280260 6:97319971-97319993 TTAAAAACTTGCTATATGGCAGG + Intergenic
1014286961 6:119510655-119510677 TTAAATACATTCATAATGGTGGG + Intergenic
1016587291 6:145704184-145704206 TTAAAGATTTTTTAAATGAATGG + Intronic
1018934419 6:168264387-168264409 TTAATGACTTTTAAAATGTTGGG - Intergenic
1019446187 7:1072628-1072650 TTAAAGCCTTTCTACAAGGAGGG - Intronic
1020904047 7:14043057-14043079 TGGAAGACATTCTAAATTGTAGG + Intergenic
1020973624 7:14979675-14979697 ATAAAGACTTTTTTGATGGTGGG + Intergenic
1021424432 7:20483624-20483646 TTGAAGACCTTCTAAGTGCTAGG + Intergenic
1021768101 7:23969455-23969477 TTAAAGAAGTTCTCAAAGGTGGG - Intergenic
1021779102 7:24084429-24084451 TTAGAGACTGGTTAAATGGTTGG - Intergenic
1022302757 7:29116686-29116708 TTAAAGACTATTTTACTGGTAGG - Intronic
1022785972 7:33637245-33637267 TTAAATACATTCTAAATGAAGGG + Intergenic
1022817679 7:33929069-33929091 ATAAAGTCTTTTTAAATGTTCGG + Intronic
1023625457 7:42111095-42111117 TTAAGGACTTACTACAGGGTTGG + Intronic
1024742210 7:52366515-52366537 TTAATAAGTTTCTAGATGGTAGG + Intergenic
1028970808 7:96857011-96857033 TTAAAAAAATTCTAAATGGTTGG - Intergenic
1030743025 7:113132373-113132395 TCATAGACTTGCTATATGGTTGG - Intergenic
1031229733 7:119090700-119090722 TTATTGATTTTATAAATGGTTGG + Intergenic
1031298032 7:120028675-120028697 TTAAAGACTTTCTATAAGCTAGG - Intergenic
1032954465 7:136954654-136954676 TGAAAGACTTTTGAAAAGGTAGG + Intronic
1034008756 7:147504901-147504923 TTAATCACATTCAAAATGGTCGG - Intronic
1034206702 7:149322405-149322427 AAAAAAACATTCTAAATGGTGGG + Intergenic
1035128477 7:156628884-156628906 CTAGAGACTTGCTAAATTGTTGG + Intergenic
1036094005 8:5703137-5703159 TTACAGTCTTTCTAAATTTTAGG - Intergenic
1036371217 8:8164486-8164508 TTAAATACTTTCTAAAGGCAAGG - Intergenic
1036879685 8:12501157-12501179 TTAAATACTTTCTAAAGGCAAGG + Intergenic
1038648847 8:29384135-29384157 TTAAAAAATTTTTAAATAGTAGG + Intergenic
1038696129 8:29807861-29807883 TCAAATGCTTTCTAAATGGATGG - Intergenic
1038833248 8:31086751-31086773 TTAAACACTTACTAAATGTCAGG - Intronic
1039003966 8:33012982-33013004 TTAAACACTTTCTTAATTGGTGG - Intergenic
1039042674 8:33423101-33423123 TTAAAGAATTTCTGAATCGTGGG - Intronic
1040542952 8:48376187-48376209 TTGAAGGCTATCTAGATGGTCGG - Intergenic
1041127312 8:54656616-54656638 TCAATGACTTTCTAAATGTCTGG + Intergenic
1041932716 8:63304771-63304793 TGAATGTCTTTCTTAATGGTTGG + Intergenic
1043687053 8:83100267-83100289 TTAATGACTATCTGACTGGTGGG - Intergenic
1043862180 8:85332323-85332345 TTAGAGACTTTCTCAGAGGTAGG + Intronic
1043981535 8:86646700-86646722 CAAAAGACTTTATAAATTGTAGG - Intronic
1044120859 8:88393157-88393179 TTAAACACCTTCTAAAGGCTGGG + Intergenic
1044770847 8:95631835-95631857 TTAAAGTCTTTCTAACTGAAAGG - Intergenic
1045688734 8:104738579-104738601 TTACAGACTCTGTAAATGTTGGG + Intronic
1045918494 8:107502117-107502139 TTAGAAATATTCTAAATGGTTGG + Intergenic
1047102749 8:121696078-121696100 GTGAAGAGTTTCTAAATGGAGGG + Intergenic
1047110397 8:121782859-121782881 TTAAAGACATTCTATATGTCAGG - Intergenic
1047271407 8:123362775-123362797 AGAAAGACTTTTTAAATGCTGGG + Intronic
1047813911 8:128441709-128441731 TTAAAAAAATTCTAAATGGAGGG + Intergenic
1048302507 8:133261906-133261928 TTAAGCACTTTTTAAATTGTGGG - Intronic
1049112360 8:140655012-140655034 TTAAAAACTTTTTAAAGGCTGGG - Intergenic
1050386129 9:5092975-5092997 TTGAACACTTTCTTAATTGTTGG - Intronic
1050768126 9:9162050-9162072 TTGAAGATCTTCTAAATGCTGGG - Intronic
1050872158 9:10585649-10585671 TTAAAGTATCTCTAAATTGTAGG + Intronic
1051137626 9:13940366-13940388 TTAATGACATTCTAAAAGATTGG - Intergenic
1051794492 9:20849681-20849703 TTGAAGACTTTCTAAGGGATAGG + Intronic
1052243143 9:26299243-26299265 TTACCGATTTTATAAATGGTAGG - Intergenic
1053696538 9:40644349-40644371 TTAAAGATTTCCTAAATTTTTGG - Intergenic
1054307788 9:63443577-63443599 TTAAAGATTTCCTAAATTTTTGG - Intergenic
1054406513 9:64767579-64767601 TTAAAGATTTCCTAAATTTTTGG - Intergenic
1054440143 9:65253052-65253074 TTAAAGATTTCCTAAATTTTTGG - Intergenic
1054490262 9:65768887-65768909 TTAAAGATTTCCTAAATTTTTGG + Intergenic
1055923309 9:81484337-81484359 TTGAAGACTTTCTAGATAGAAGG + Intergenic
1056369379 9:85939282-85939304 TTAAAAAATTTTTAAATGGCCGG - Intergenic
1056977943 9:91277624-91277646 TTTAAAAATTTCTAAATGGCAGG + Intronic
1057058114 9:91979452-91979474 TTAAAGACTACCAAAAAGGTAGG - Intergenic
1057960245 9:99448342-99448364 TTTGATACTTTCTAAATGCTAGG - Intergenic
1058400235 9:104608234-104608256 TTAACTACTTTTTAAATGTTTGG + Intergenic
1058409310 9:104713272-104713294 TTGATCACATTCTAAATGGTGGG + Intergenic
1058722159 9:107773959-107773981 CTAGAGACTTGTTAAATGGTTGG - Intergenic
1059214521 9:112548283-112548305 TCAAAGATTTTCTGAATGGCCGG - Intronic
1202778988 9_KI270717v1_random:18009-18031 TTAAAGATTTCCTAAATTTTTGG - Intergenic
1203586056 Un_KI270747v1:4418-4440 TTAAAGATTTCCTAAATTTTTGG - Intergenic
1186081241 X:5935517-5935539 TTAAAAACTGTTTAAGTGGTTGG - Intronic
1187860115 X:23673792-23673814 TTTAATATTTTCTAAAGGGTAGG - Intronic
1188176220 X:26993993-26994015 TTTAAGATTTTCTAAGTGTTGGG - Intergenic
1188716923 X:33470403-33470425 TGGAAGACTTTCTAAAGGATTGG + Intergenic
1194465217 X:94226359-94226381 TTTAAAAATTTCTAAATGATTGG + Intergenic
1194923782 X:99798721-99798743 TTAATGAATTAATAAATGGTTGG + Intergenic
1195024720 X:100864901-100864923 TCAAAGACTTTCTAAAAGGAGGG + Intronic
1195663536 X:107406488-107406510 TTTAAGTCTTACTAACTGGTAGG + Intergenic
1196058688 X:111384653-111384675 TTAGTGACTTTCTTAATAGTAGG - Intronic
1197448634 X:126582415-126582437 TTTAAAACTTTCCAAATCGTGGG + Intergenic
1198213512 X:134536194-134536216 TCAAGTACTTTCTAAATGCTGGG - Intergenic
1198419271 X:136452753-136452775 ATAAGGACTTTCTAACTGATTGG - Intergenic
1198652430 X:138877456-138877478 TTAAAAACTATTTAAATGGCTGG - Intronic
1199408156 X:147486512-147486534 TTAAAGACATTCTACATGTGCGG - Intergenic
1201194281 Y:11476282-11476304 TTAAAGATTTCCTAAATTTTTGG - Intergenic
1202036585 Y:20642877-20642899 TTTTAGACTGTCTAAATGTTAGG - Intergenic