ID: 1156133846

View in Genome Browser
Species Human (GRCh38)
Location 18:34011533-34011555
Sequence TTCTCAAGGCATCTACAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156133846 Original CRISPR TTCTCAAGGCATCTACAGAC TGG Intronic
902850907 1:19155638-19155660 GACTCAAGGCATCAACACACAGG + Exonic
904681444 1:32232173-32232195 TTCACACGGCATCTGCAGAAAGG + Intergenic
906127179 1:43434066-43434088 TTCTCAAGTCTTCTTCAGAATGG - Intronic
906974289 1:50552666-50552688 TTCTGAAGGAATATATAGACAGG + Intronic
908154406 1:61337696-61337718 TTCTCAAGGCATTTTTAGATTGG + Intronic
908845242 1:68317878-68317900 TTCGCAAAGCATCAACACACAGG - Intergenic
910197477 1:84658607-84658629 TTCTCAAGACATTTAAATACTGG - Intronic
914672878 1:149885322-149885344 TTCTCAAGCCCTTGACAGACCGG - Exonic
916000795 1:160613330-160613352 TTCTCAAGGAATGTATAGACTGG - Intronic
920059796 1:203219424-203219446 TTCTCCAGGCTTCCTCAGACAGG - Intronic
1064087215 10:12354226-12354248 TTGTCCAGCCATCTACAGACAGG - Intronic
1068885838 10:62096165-62096187 TTATCAGGGCATATACAGAAGGG + Exonic
1072274410 10:93808754-93808776 TACTCAGGCCATCTAAAGACAGG - Intergenic
1073600334 10:104840183-104840205 TTCTCATGGCAGCTACTGAGAGG + Intronic
1073775022 10:106775492-106775514 TTCCCAAGGTCTCTACTGACAGG - Intronic
1073902430 10:108238737-108238759 TGCTAAAGTCATCTACACACAGG - Intergenic
1078871297 11:15347678-15347700 AACTCATGGCATCTACAGAATGG - Intergenic
1082888896 11:58117542-58117564 TTCTCAAGGGTTTTACAGTCTGG + Intronic
1084438275 11:69156675-69156697 TTCTGAAGGCATCCACTGAGAGG + Intergenic
1090076653 11:123584131-123584153 TTCTCAAGGCAGTTCCAGAAAGG - Intronic
1091023718 11:132123721-132123743 TGCTAAAGGCATCAACAGCCTGG + Intronic
1095991588 12:48038106-48038128 TTCTCTTGGCTTCTCCAGACAGG - Intergenic
1098348818 12:69535125-69535147 TCCTCAAGGCATCCAAAGATAGG + Intronic
1099048367 12:77752317-77752339 TTCTAAAGGGATCTATAGACAGG + Intergenic
1099741717 12:86645484-86645506 GTGTCAAGGCATTTTCAGACAGG + Intronic
1101224524 12:102674741-102674763 TTCTCAAAGGATCTAGAGAATGG + Intergenic
1103590992 12:121992163-121992185 CTCTCAAGCCATCTTCACACGGG + Intronic
1106204575 13:27579053-27579075 TTCTAAAGGAATCTACAACCCGG + Intronic
1107010891 13:35669914-35669936 TTCACCAGGCATGAACAGACAGG + Intronic
1109342828 13:61083808-61083830 TTCTAAAAGAATCTATAGACTGG + Intergenic
1111646463 13:91038028-91038050 TCCTCAATGAATTTACAGACAGG - Intergenic
1111834682 13:93373542-93373564 TTCTCAAGGATTCAACATACAGG - Intronic
1119387235 14:74265308-74265330 TTCTCATGGCACTTACAGTCTGG + Intergenic
1119738339 14:76998291-76998313 TGCTCATGGCATCCACAGAAAGG - Intergenic
1119883263 14:78118927-78118949 GTTTCAAAGCATCAACAGACTGG - Intergenic
1120447048 14:84612222-84612244 TTCTAAAGTTATCTCCAGACTGG + Intergenic
1121300507 14:92866900-92866922 TTATCAAGGCAGCTTCAGTCAGG - Intergenic
1122706518 14:103625293-103625315 TTCTTCAGGCATTCACAGACAGG + Intronic
1122918591 14:104870343-104870365 TTCTCAAGCCATCTAAAGACAGG + Intronic
1137339947 16:47591719-47591741 TTCACAAGGCAGCTGCATACAGG - Intronic
1139158834 16:64478273-64478295 CTCTCAGTGCATCCACAGACAGG - Intergenic
1140491502 16:75340364-75340386 TTCTCTAGTAAGCTACAGACAGG + Intronic
1143832609 17:9664473-9664495 TTCTAAAGGTATATATAGACAGG + Intronic
1150161962 17:62906075-62906097 TTCTCAGTGCTTCTACAGCCTGG + Intergenic
1152454986 17:80409749-80409771 TTCTCCAGGATTCTACAGCCTGG + Intergenic
1153906000 18:9661740-9661762 TCCTGAAGGCATCTGCAGAGAGG + Intergenic
1156133846 18:34011533-34011555 TTCTCAAGGCATCTACAGACTGG + Intronic
1159168097 18:64726907-64726929 TTTTCAATGGATATACAGACAGG + Intergenic
1164041951 19:21500693-21500715 TTCCCCAGGCCTCTACAAACAGG - Intronic
1168508805 19:56958286-56958308 TACTCAAGACATCTGTAGACAGG + Intergenic
927374871 2:22402038-22402060 ACATCAAGGTATCTACAGACAGG + Intergenic
927633815 2:24796913-24796935 TTCTCTAGGCATTTCCACACAGG - Intronic
928219202 2:29389172-29389194 TTCTCAAGGAGCTTACAGACTGG + Intronic
930059642 2:47277515-47277537 CTCTCAGGGCATTTACAGTCTGG + Intergenic
930690118 2:54353507-54353529 TTTTCAAGGCTTCTGCAGAGGGG + Intronic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
932801446 2:74745816-74745838 TTCCCAGGGCATCCACGGACAGG + Intergenic
935652561 2:105394768-105394790 TACTAAATGCATGTACAGACAGG + Intronic
936901953 2:117491191-117491213 TTCTCTAGGCATCTGCATCCAGG + Intergenic
936947434 2:117943150-117943172 TTCTAAGGGCAGCTTCAGACTGG - Intronic
940854673 2:158720613-158720635 TTCTCAACTCATCTACATCCTGG + Intergenic
941389420 2:164893343-164893365 TTCTCAAGGAATTTTTAGACTGG + Intergenic
941660226 2:168188940-168188962 TTCTCAAGGCAGCTACAAACTGG + Intronic
943070022 2:183129997-183130019 TTATTCAGGAATCTACAGACTGG + Intronic
944426865 2:199592636-199592658 CTCTGAAGGCGTCTATAGACCGG - Intergenic
947191568 2:227511533-227511555 TTCTCACGTCATATACAGCCAGG - Intronic
947932974 2:233979315-233979337 TTCTCAAGGAATCTACTGTTTGG - Intronic
948190152 2:236051981-236052003 TTCTCACGTCATGGACAGACCGG - Intronic
1178578605 21:33817050-33817072 TTCTAAAGGCATGTACAAATTGG + Intronic
1182037676 22:27212151-27212173 TTCTAAATGCATGTACACACTGG + Intergenic
1182547504 22:31084642-31084664 ATCTCAAGGTATCCACAGGCAGG + Intronic
1182886271 22:33776878-33776900 TCCACAAGGCACCTACTGACTGG + Intronic
951793635 3:26514654-26514676 TTCTGAAGTCATCAATAGACGGG - Intergenic
952007038 3:28853814-28853836 TACTCAAGGCAAGTCCAGACAGG + Intergenic
956872352 3:73430549-73430571 TCCTCAAAGCATCCACAGACTGG + Intronic
959620928 3:108397916-108397938 TTGTCAGGGCATCCACAGCCAGG - Intronic
963403122 3:144826806-144826828 TTTTCAAGGAGTCTGCAGACTGG - Intergenic
964145421 3:153455696-153455718 TTCTCTAGGCATCTAAAACCTGG - Intergenic
970562481 4:17296242-17296264 TTCTCAATGGGTCTACAGTCTGG - Intergenic
972068819 4:34987785-34987807 ATTTCAAGGCTCCTACAGACTGG - Intergenic
973550354 4:52028730-52028752 TTCAAAAGGCATCTACTGAAAGG - Exonic
975105357 4:70562104-70562126 TTCTCATATCATATACAGACAGG + Intergenic
975404414 4:73973110-73973132 GACTCATGGCATCTACAAACAGG - Intergenic
976011547 4:80495106-80495128 TTGTTAAGGCATATATAGACAGG + Intronic
976091352 4:81461222-81461244 TTCTCAGGGCAAGGACAGACTGG - Intronic
977142705 4:93394520-93394542 TTCCAAAGTCATCTACATACTGG - Intronic
980127335 4:128786645-128786667 CTCGCAAGGCAGCTAGAGACAGG - Intergenic
981383774 4:144103209-144103231 TTCTCAAGGATTCTGCAGACAGG - Intergenic
982336985 4:154251037-154251059 TTCTCAGGGCATCAATAGACTGG + Intronic
986331498 5:6719602-6719624 TTCTCAAGGCAGGTTCAGAGTGG - Intronic
987301985 5:16605467-16605489 ATCTCCAGGCATCTAGAGAATGG + Intronic
987369901 5:17183618-17183640 TTCTAAAGGCAGCTCCAGCCGGG - Intronic
991307671 5:65197137-65197159 TTCTCAAGGTGTCCAAAGACAGG - Exonic
993042038 5:82825154-82825176 TTCTCAAGGCTTCCCCAGACAGG - Intergenic
995317022 5:110786637-110786659 TTTTCTAGGTATCTACAGACTGG + Intergenic
998219897 5:140268674-140268696 TACTCAAGGAATCTAAACACAGG + Intronic
999876221 5:155809203-155809225 TTCTCAAGAAATCCACCGACTGG + Intergenic
1001049973 5:168406219-168406241 TGCTCAGGGCAGCTACAAACTGG + Exonic
1002807791 6:593975-593997 ATATCCAGGCATCTGCAGACGGG + Intronic
1009774175 6:68183572-68183594 TTCTAGAGGCCTCTATAGACTGG + Intergenic
1012082002 6:94771048-94771070 TTCTCAAGCCATCAACACAATGG + Intergenic
1012387561 6:98699771-98699793 TACTGAAGGGATCTCCAGACTGG - Intergenic
1012947981 6:105488054-105488076 TGCACAATGCATCTGCAGACTGG - Intergenic
1015800825 6:137060800-137060822 TTCTCAAGGCTGCTTCAAACGGG + Intergenic
1016352980 6:143187840-143187862 TTCTCAAGCGATGTACAGAAGGG + Intronic
1017518183 6:155176794-155176816 TTCTTTTGGCATCTACAAACAGG + Exonic
1018253956 6:161899726-161899748 TTCTCCAGTCATCTACAAATAGG + Intronic
1019947672 7:4342914-4342936 TTCTCAAGGAATCTGCAGATAGG + Intergenic
1022338784 7:29448873-29448895 TTCTCAAGGAGTTTACAGTCTGG - Intronic
1022887832 7:34664449-34664471 TTCTCAAGACAACTACTGAGAGG + Intronic
1023249884 7:38247309-38247331 TTCTCAAGGCAACTACATTAAGG - Intergenic
1027201659 7:76067792-76067814 TTCACAACGCATCTACAGCAAGG + Intergenic
1027267264 7:76501263-76501285 TTCTCATGGACTCAACAGACTGG - Intronic
1027649021 7:80841596-80841618 TTCTGAAGGAATCTAGAGATGGG - Intronic
1030282314 7:107789793-107789815 TCTTCAAGGCATGTACATACAGG - Intronic
1034029068 7:147740066-147740088 TTCTCCAGGCATCCACAGAGGGG + Intronic
1038089706 8:24239564-24239586 TTTTCCAGGATTCTACAGACTGG + Intergenic
1038449641 8:27631807-27631829 ATCTGATGGGATCTACAGACAGG + Intergenic
1038922691 8:32102501-32102523 TCCTCAAGGAATTTACAGTCTGG + Intronic
1039257993 8:35740128-35740150 ATCTCAAGGCATGAAAAGACTGG + Intronic
1044463609 8:92478009-92478031 TATTCAAGGCCTCAACAGACAGG - Intergenic
1044560133 8:93604717-93604739 TTCTCAAAGCAAATACATACTGG + Intergenic
1047022993 8:120796218-120796240 TTCCCAAGGCATCTCCAGCCAGG + Intronic
1047341527 8:123985110-123985132 TTCTCAAGGAGTCCACAGTCTGG - Intronic
1048705496 8:137148616-137148638 TTTTCAAGGAATTTACAGTCAGG + Intergenic
1050451965 9:5791368-5791390 TTCTCAAGGCCTTCACTGACGGG + Intronic
1050522194 9:6512509-6512531 TTCTCTTGGCATCTAGAAACTGG - Intergenic
1050666767 9:7946834-7946856 TTTTCAAGGCAGCAACAGATGGG - Intergenic
1051729286 9:20122743-20122765 TTCTCTAGGCATCAAAAGAGGGG - Intergenic
1059270642 9:113068506-113068528 TTCTCTAGTCATCTACTGATGGG - Intergenic
1059271777 9:113073953-113073975 TTCTCTAGTCATCTACTGATGGG - Intergenic
1059272911 9:113079400-113079422 TTCTCTAGTCATCTACTGATGGG - Intergenic
1059274046 9:113084842-113084864 TTCTCTAGTCATCTACTGATGGG - Intergenic
1060212171 9:121717287-121717309 ATCTCAGGGCAGGTACAGACAGG + Intronic
1061523627 9:131138700-131138722 TTCTCAAGGAATCTGGGGACAGG + Intronic
1061544195 9:131294441-131294463 GTCTCAAGGCATCTAGAGCTTGG - Intronic
1203564367 Un_KI270744v1:79465-79487 TTCCCGCAGCATCTACAGACAGG - Intergenic
1186863396 X:13695094-13695116 TTCTCGAGACTTCTCCAGACAGG - Intronic
1192350836 X:70355048-70355070 TTCCCAAGGCATAAACAGTCAGG + Intronic
1193056742 X:77160147-77160169 TTCTCCATGCATATACACACTGG - Intergenic
1197918004 X:131556894-131556916 TTCTCATGTCATCTGCAAACAGG - Intergenic
1199623179 X:149716734-149716756 CTCTCAAAGCATCTTCATACAGG - Exonic
1200021701 X:153216730-153216752 TTCTCAAGGGATCCACAATCCGG - Intergenic