ID: 1156145637

View in Genome Browser
Species Human (GRCh38)
Location 18:34174020-34174042
Sequence TCTTATGAAACATGACCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156145636_1156145637 23 Left 1156145636 18:34173974-34173996 CCGATTCATGATTCTGATTAATT 0: 1
1: 0
2: 0
3: 19
4: 276
Right 1156145637 18:34174020-34174042 TCTTATGAAACATGACCTAATGG 0: 1
1: 0
2: 0
3: 12
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156145637 Original CRISPR TCTTATGAAACATGACCTAA TGG Intronic
902689996 1:18105118-18105140 TCTTATGAAACAGGAGCTGGAGG + Intergenic
906721189 1:48005979-48006001 TCTTGCTTAACATGACCTAATGG - Intergenic
908137922 1:61152069-61152091 CCTTAGGTAACATGACCCAATGG + Intronic
910025545 1:82646812-82646834 TTTTATGAGACAGGACCTGATGG - Intergenic
910682932 1:89885885-89885907 TCTTATGAAAACTGATGTAAAGG - Intronic
912631744 1:111252441-111252463 TCTGATGACCTATGACCTAAGGG + Intergenic
915945477 1:160147676-160147698 TTTTATAAAACATGACATATTGG + Intergenic
916636683 1:166677728-166677750 TCTTATGAAACATAATATAGAGG - Intergenic
917273551 1:173305170-173305192 TGTTATGAAACATGCCAAAAGGG + Intergenic
918844358 1:189589735-189589757 TCTTATAAAGAAAGACCTAAAGG - Intergenic
919109254 1:193197293-193197315 TATTATATACCATGACCTAATGG - Intronic
919597830 1:199586514-199586536 TCTTATGAAAAAGGATCTTATGG - Intergenic
1065759327 10:28967256-28967278 TCTCCTGAAAAATGACATAAGGG - Intergenic
1068011682 10:51459441-51459463 TTTTATGAACCATGACCTAGAGG + Intronic
1068079537 10:52302792-52302814 TTTCATGAAACATGACCATATGG - Intergenic
1069395947 10:67987975-67987997 TTAGATGAGACATGACCTAAGGG - Intronic
1071112628 10:82177772-82177794 TGTTATTAAACATGAACAAATGG + Intronic
1074328054 10:112472400-112472422 TCCTTTGAACCCTGACCTAAGGG - Intronic
1077981842 11:7308824-7308846 TCTTAAGAGACAGGACGTAATGG - Intronic
1078603396 11:12753546-12753568 TTTTATGAAACATAACCAAATGG - Intronic
1079518507 11:21296787-21296809 TCCCATGAATCTTGACCTAAAGG - Intronic
1080029346 11:27644603-27644625 TCTTATTAAAAATGGCCTTATGG - Intergenic
1080910977 11:36598259-36598281 TCTTATGAACACTGATCTAATGG + Exonic
1082652365 11:55808990-55809012 GCTTATGAAACATGGCCCCAGGG + Intergenic
1085191374 11:74627095-74627117 TCTTTTGAAATATCTCCTAAGGG - Intronic
1088580704 11:111312866-111312888 TTTTCTGAAGTATGACCTAATGG - Intergenic
1088907820 11:114168177-114168199 TCATTTGAAAAATAACCTAATGG + Intronic
1089942400 11:122432263-122432285 TCTTGTAAAACATGAAATAAAGG + Intergenic
1091597123 12:1885635-1885657 TCTCATGAAAACTGACATAATGG + Intronic
1092676084 12:10922289-10922311 TTTTATAAAACATGTACTAATGG + Intronic
1092839232 12:12523046-12523068 AATTAGGAAACATGATCTAAAGG - Intronic
1093158078 12:15712572-15712594 TCTTAAATACCATGACCTAAAGG + Intronic
1093435195 12:19129089-19129111 TTTTATAAGATATGACCTAAGGG + Intergenic
1093869706 12:24274128-24274150 AATTAAGAAACATGACCTTATGG - Intergenic
1093987006 12:25545733-25545755 TTTTAGGAAACATGGCATAAAGG + Intronic
1094223863 12:28024424-28024446 TCTTATGAGCCATGAGCTAAAGG - Intergenic
1094312386 12:29098620-29098642 TTTTCTGATACATGACCTCAGGG - Intergenic
1095689731 12:45073831-45073853 TCTTATGAAACATTTGCTTAAGG + Intergenic
1098177765 12:67810708-67810730 TCTTATGTATCATTACCCAAGGG - Intergenic
1099281291 12:80650634-80650656 TCTTAAGAAGCATAACCAAAAGG - Intronic
1100737377 12:97551717-97551739 TGATATGAAGCATAACCTAAGGG - Intergenic
1102361216 12:112289516-112289538 TTTTATGAAAAATGACATAATGG + Intronic
1105302071 13:19144252-19144274 TTGTATGAAAGATGACATAATGG - Intergenic
1105767600 13:23577528-23577550 TCTTATGATACAGGACACAATGG + Intronic
1106424938 13:29618517-29618539 TCTTATAAAAAATCAACTAAAGG + Intergenic
1107904506 13:45049899-45049921 TCTTCTGAAACATGGACTAGGGG - Intergenic
1114854597 14:26423278-26423300 ACTTAGGGAACCTGACCTAAGGG - Intergenic
1115034305 14:28838622-28838644 GGTTATTAAACATGACCAAATGG + Intergenic
1116633069 14:47358030-47358052 TTTTTTGAAACAAGACCTCAAGG - Intronic
1117097184 14:52310967-52310989 TCTCTTGAAGAATGACCTAAAGG + Intergenic
1120085993 14:80273996-80274018 TGTTATGTAGCATTACCTAAGGG - Intronic
1121063629 14:90940049-90940071 TCCTCTGAAACTTGATCTAATGG - Intronic
1121399673 14:93662515-93662537 TCTTATGATACTTTAACTAATGG - Intronic
1124499015 15:30210233-30210255 TCTTCTAAAACATTACATAATGG + Intergenic
1124502267 15:30239244-30239266 TCCTATGAAATATCACTTAAAGG + Intergenic
1124741296 15:32299408-32299430 TCCTATGAAATATCACTTAAAGG - Intergenic
1124744561 15:32328440-32328462 TCTTCTAAAACATTACATAATGG - Intergenic
1124836377 15:33199433-33199455 TTTTACTAAACATGAACTAAGGG - Intergenic
1132170574 15:99649295-99649317 TCTTATGAATCTTACCCTAATGG - Intronic
1132513758 16:356606-356628 ACTTATAAAAAATGACCCAAAGG + Intergenic
1135005136 16:18814117-18814139 TCTTTTTAAAAATGACTTAATGG - Intronic
1135508054 16:23056193-23056215 TCTTATGTAAGATGACCTGAAGG + Intergenic
1138433144 16:56982221-56982243 ACTTACGAGACATGACCTCAGGG - Exonic
1138954587 16:61955248-61955270 TATAATGAACCATAACCTAATGG + Intronic
1141385977 16:83622995-83623017 GCTTTGGGAACATGACCTAAGGG + Intronic
1145762277 17:27432171-27432193 GCTAAGGAGACATGACCTAAAGG - Intergenic
1146424877 17:32728164-32728186 TATTAGCAAACTTGACCTAATGG + Intronic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1149164474 17:53734696-53734718 GCTTATGAAAGATTACCAAAAGG + Intergenic
1150181353 17:63124259-63124281 TCTTAAGAAATACAACCTAAGGG + Intronic
1153955654 18:10093437-10093459 TCTAATGAAAGATGTCCTAGTGG + Intergenic
1156145637 18:34174020-34174042 TCTTATGAAACATGACCTAATGG + Intronic
1159263048 18:66041267-66041289 TCTTTTAAAACATGAATTAAAGG - Intergenic
1160103080 18:75942149-75942171 TCTTATGTATCATTACCAAAAGG + Intergenic
1162677266 19:12308486-12308508 GCTTATGAAACATGACATTTTGG - Intergenic
1165691224 19:37865223-37865245 TCTAATTAACCATGACCAAAAGG + Intergenic
926351319 2:11997629-11997651 TCTCATGTAAAATAACCTAATGG - Intergenic
927202876 2:20589376-20589398 CCCTGTGGAACATGACCTAAAGG + Intronic
929728376 2:44457696-44457718 TTTTAAGAAATATGACTTAAGGG - Intronic
929836292 2:45403530-45403552 TCTTATGATCCATGTCCTATTGG + Intronic
931456796 2:62415905-62415927 TCTTAGGATACATTCCCTAAAGG - Intergenic
931814237 2:65885008-65885030 TGTTATGAAGAATGACTTAATGG + Intergenic
931914042 2:66933662-66933684 ACTAATGAACCATGTCCTAATGG + Intergenic
931915727 2:66952969-66952991 TCTTATCAAAGATGTCCTGAAGG + Intergenic
932711339 2:74066245-74066267 TCTTATTAAGCATAACATAAAGG - Intronic
933071341 2:77862162-77862184 CCTTGTGAAATATAACCTAAGGG - Intergenic
933247120 2:79988015-79988037 TCTCAAGAATCATGAACTAATGG - Intronic
935494803 2:103767076-103767098 TTTTACTAAACATTACCTAATGG + Intergenic
937222786 2:120351693-120351715 TATTATGAAACAGAATCTAAGGG - Exonic
939435532 2:142172424-142172446 TCTTATGGTACATGAACTAATGG + Intergenic
941011711 2:160307636-160307658 ACTGATGAAACTTAACCTAATGG - Intronic
941457223 2:165723860-165723882 TCTTATGTTACATGACAAAAGGG + Intergenic
941485388 2:166073736-166073758 TGTCATGAAACATGAGCTAGAGG + Intronic
943050835 2:182911083-182911105 TCTTAGGAAAGAACACCTAATGG - Intronic
944867569 2:203877675-203877697 GCTTATGAACTATGGCCTAAAGG - Intergenic
947715319 2:232336237-232336259 GCTTATGAAACACAACCTGAGGG - Intronic
1174664640 20:52246596-52246618 TGTGATGAAAAATCACCTAATGG - Intergenic
1177203131 21:17979829-17979851 CCTTAGGAAACATGGCATAAAGG - Intronic
1177842675 21:26252114-26252136 TCTTAAGAACAATGACCTAATGG - Intergenic
1182958061 22:34445901-34445923 TGCTATGAAACCTGTCCTAAGGG - Intergenic
952036460 3:29207944-29207966 TTTTATTAAACATGGACTAAAGG - Intergenic
954258966 3:49425172-49425194 GCTTATGAAACATGAGGTTAGGG + Intronic
957122702 3:76116183-76116205 TCTTTTGAGGCATTACCTAAGGG - Intronic
957466983 3:80606622-80606644 TCTGTTGAAACATAACCTAAGGG + Intergenic
957497075 3:81006608-81006630 TATTATGAAACGTTATCTAATGG + Intergenic
959194786 3:103166327-103166349 TCTTTTGGAACATCTCCTAAAGG + Intergenic
959943635 3:112105422-112105444 ACTTCTGAAACTTGACCTAATGG - Intronic
960914499 3:122681906-122681928 TCTTATGGATGATGACCTATCGG + Intronic
962670679 3:137704881-137704903 TCTTCTGAAATATGTCCTAAAGG + Intergenic
963507568 3:146206477-146206499 TCTTATGAAATGTGACCATAGGG - Intronic
964151278 3:153527601-153527623 TCTGATGAAACATTACTTACTGG + Intergenic
964348515 3:155779593-155779615 TTTTATGAAATATGATCTCATGG - Intronic
966961151 3:184940510-184940532 TCTTCTGAAACATGTCCTTGTGG - Intronic
970676896 4:18461122-18461144 TCCAATGAAACATGACAAAAAGG - Intergenic
972593556 4:40510455-40510477 ACTTGTGATCCATGACCTAAGGG + Intronic
973157828 4:46979083-46979105 ACTTCTGTAACAGGACCTAACGG + Exonic
973977495 4:56277280-56277302 GCTTAAGTAACATGACCAAATGG + Intronic
976639372 4:87321328-87321350 TCGTATTAAAAATGACTTAAGGG - Intronic
977340472 4:95751187-95751209 TCTTTTGACACCTGACCAAAGGG + Intergenic
980056202 4:128082434-128082456 TCTTATGAAATATACCCTGAAGG - Intronic
981552075 4:145952111-145952133 TCATATTTAACATGACCTAGTGG - Intergenic
981798881 4:148633128-148633150 TCTTCTGGAACATGTCCTGAAGG + Intergenic
981987304 4:150873886-150873908 CCTTTTAAAACATGAACTAAAGG + Intronic
988360853 5:30234772-30234794 TGTTATGAACTATAACCTAAAGG - Intergenic
990720102 5:58685043-58685065 TCTTATTAAACATAAGCTTAAGG - Intronic
992143022 5:73818403-73818425 TCTGATGAAACTTGACAAAAGGG - Intronic
993681954 5:90889766-90889788 TCATATGAAACATTAACAAATGG - Intronic
994037221 5:95215383-95215405 TCTTATGAAAGAAGACAGAAAGG - Intronic
994503065 5:100604726-100604748 CATTTTGAAACATGATCTAAAGG - Intergenic
994901133 5:105770949-105770971 TCTTATGAAACAAGATTGAATGG + Intergenic
995471797 5:112510182-112510204 TCTTCTGAAACATCTCCTGAAGG + Intergenic
995958800 5:117813916-117813938 TATTATGATACATGACAAAATGG + Intergenic
998148840 5:139745780-139745802 TCAAGTGAAACATGACCTCAGGG + Intergenic
1000949736 5:167466005-167466027 CCTTAAGAAAAAAGACCTAATGG + Intronic
1005215244 6:23519322-23519344 TCTTCTGAAACATTCCCTTAGGG - Intergenic
1007894623 6:45340622-45340644 TCTGATCAAACTCGACCTAAAGG - Intronic
1010408338 6:75531712-75531734 TATTTTGGAACATGAACTAAAGG - Intergenic
1010424815 6:75717376-75717398 TCTTATCAAACATTATCTAAGGG - Exonic
1012305418 6:97650923-97650945 TCTAATGAAACATTACTCAAGGG - Intergenic
1012605011 6:101146954-101146976 TCTGAGGAAAAATGAGCTAAAGG - Intergenic
1013784667 6:113766012-113766034 TCTTGGGAAACAAGAGCTAAAGG - Intergenic
1015564294 6:134551529-134551551 TCTTAGGAGTCATGACCTTAGGG + Intergenic
1016161775 6:140891150-140891172 GCTTATGATTCATGTCCTAAAGG + Intergenic
1016584672 6:145670595-145670617 TCTTAAGAAACAAGAATTAAGGG + Intronic
1017323652 6:153121661-153121683 TATTTTGAAACAAGACATAAAGG + Intronic
1024631507 7:51251940-51251962 TCTTAGGAGACATGTGCTAAAGG - Intronic
1027645542 7:80793352-80793374 TATTCTGAAAACTGACCTAATGG - Intronic
1028132960 7:87198650-87198672 TCTTTTAAAACTTGACCAAAGGG + Intronic
1036734507 8:11298946-11298968 TATGATGATACATGACCAAATGG + Intronic
1037415272 8:18643299-18643321 TCTTATGAAGCCTTGCCTAATGG + Intronic
1039667504 8:39550313-39550335 TCTTATGAAACCTTACCAATGGG - Intergenic
1040340944 8:46440535-46440557 TGTTTTGAAACATGGCCTCATGG - Intergenic
1040699137 8:50039828-50039850 TCTTCTGAATCATGACTTACGGG - Intronic
1040929662 8:52720642-52720664 TTTTAAAAAGCATGACCTAACGG + Intronic
1041029899 8:53726247-53726269 TCTCATTTAACATGACATAATGG + Intronic
1042702142 8:71627035-71627057 TCTTATAAAACATGAAATACTGG + Intergenic
1042972629 8:74427443-74427465 GCTTATGACACATGACTCAATGG + Intronic
1043731216 8:83685568-83685590 TTTTATGAAACATTACATTAGGG - Intergenic
1043847684 8:85180320-85180342 TATTATCAAACATGTCTTAATGG - Intronic
1044939309 8:97324512-97324534 TCTAATGAAACATATTCTAATGG - Intergenic
1046568035 8:115925925-115925947 TCATATGAAAAATGACCTCTGGG + Intergenic
1051159736 9:14193533-14193555 ACTTATGAACCATTTCCTAAAGG - Intronic
1060018286 9:120106564-120106586 TCTTATGAGGCTTGACCTCAGGG + Intergenic
1062522265 9:136963194-136963216 TCTTCTGAAACATCTCCCAAGGG + Intergenic
1189076974 X:37926405-37926427 TCTTGTGAAACATGTTCTATTGG - Intronic
1190894408 X:54602608-54602630 TTTTATGTAATATAACCTAATGG - Intergenic
1195990072 X:110673443-110673465 TCTTAAGTATCTTGACCTAAAGG + Intergenic
1196628144 X:117902134-117902156 TCTAATGTAACATGTACTAATGG - Intronic
1197033154 X:121843317-121843339 TCTTCTGAAACTTGAACTAGGGG + Intergenic
1199080897 X:143575957-143575979 TCTTATACAACATGACCTATAGG - Intergenic