ID: 1156147863

View in Genome Browser
Species Human (GRCh38)
Location 18:34207986-34208008
Sequence TGACACCTGCAGAATGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156147863_1156147867 -6 Left 1156147863 18:34207986-34208008 CCCTCCACATTCTGCAGGTGTCA 0: 1
1: 0
2: 1
3: 27
4: 230
Right 1156147867 18:34208003-34208025 GTGTCAAGGAACCCTATTCCTGG 0: 1
1: 0
2: 1
3: 6
4: 65
1156147863_1156147868 2 Left 1156147863 18:34207986-34208008 CCCTCCACATTCTGCAGGTGTCA 0: 1
1: 0
2: 1
3: 27
4: 230
Right 1156147868 18:34208011-34208033 GAACCCTATTCCTGGTCCTCTGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156147863 Original CRISPR TGACACCTGCAGAATGTGGA GGG (reversed) Intronic
900630037 1:3629993-3630015 GGCCACCTGCAGGATGTGCAGGG + Exonic
902206347 1:14870970-14870992 TGATATCTGGAGAATGAGGAAGG + Intronic
902651859 1:17842611-17842633 TGCCACCTGCAGCAAATGGATGG - Intergenic
905935760 1:41822823-41822845 TGACAGCTGCAGAATGCGGCAGG + Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
908418609 1:63937471-63937493 TGACATCTGCAGAAGTTAGAAGG - Intronic
909977701 1:82064646-82064668 TGAGACCTGCAAAATGAGTAGGG - Intergenic
910765086 1:90773997-90774019 TAACACCTGCTGCATGTGGTAGG - Intergenic
912233867 1:107827298-107827320 TCACACCTGGAGAATAAGGAAGG - Intronic
912708328 1:111931367-111931389 TGAAACCAACAGGATGTGGAAGG + Intronic
915287217 1:154860703-154860725 GGACACCTGCAGACAGTGGAGGG + Intronic
916854754 1:168738120-168738142 AGGCACCAGCAGAATATGGAAGG + Intergenic
918771173 1:188562222-188562244 AGACATCTGAAGAAGGTGGAAGG + Intergenic
920743807 1:208606664-208606686 TGACACAGGCAGATTGGGGATGG - Intergenic
920880020 1:209871376-209871398 TTCCACCTAAAGAATGTGGATGG - Intergenic
922230794 1:223683907-223683929 TCTCACCTGTAGAATGTGGCTGG - Intergenic
923558728 1:235022172-235022194 TGTCTCCTGCAGAATGAGCACGG + Intergenic
924454901 1:244211321-244211343 TGAAGCCTGCAGAAGGTAGAGGG - Intergenic
1063927744 10:10997125-10997147 TGACACATGCAGTACGTGGAAGG - Intergenic
1067258230 10:44663849-44663871 GGAAACCTGTAGAATGGGGAAGG + Intergenic
1071499054 10:86190573-86190595 GCACACCTGCAGGATGGGGATGG - Intronic
1071549600 10:86556524-86556546 TGACAGCTGAATAATGAGGAGGG + Intergenic
1071887718 10:89969094-89969116 GGGCAGCTCCAGAATGTGGATGG + Intergenic
1073307219 10:102512699-102512721 TGGCACTAGAAGAATGTGGAAGG + Intronic
1073343861 10:102767189-102767211 TGCCATCTCCAGAATGTGCAGGG - Intronic
1074889556 10:117724062-117724084 TGACAGCTTCACACTGTGGAGGG + Intergenic
1075579479 10:123606192-123606214 TGACACCAGGAGAATCTGCAAGG + Intergenic
1075731733 10:124640413-124640435 TGGCCCCTGAAGAATGTGCAGGG + Intronic
1075823741 10:125335974-125335996 TGTCATCTGCTGTATGTGGAAGG + Intergenic
1076648063 10:131967436-131967458 TTACATTTGGAGAATGTGGATGG - Exonic
1077997549 11:7466977-7466999 GGCCACCTGCAGAAGGTGGCTGG - Exonic
1079121933 11:17692156-17692178 TGGAACCTCCAGCATGTGGATGG - Intergenic
1080390911 11:31845608-31845630 TGACACCTGCTGAATCTTGGAGG + Intronic
1080730214 11:34943110-34943132 TGAAACCTGAGGAATGGGGATGG + Intronic
1081039265 11:38191010-38191032 TTTGACCAGCAGAATGTGGAAGG - Intergenic
1081336577 11:41874235-41874257 TGTAAACTGCACAATGTGGAGGG - Intergenic
1081721614 11:45293779-45293801 TGCCACCCGGAGGATGTGGAGGG + Intergenic
1084768464 11:71327329-71327351 TGCCACCTGCACCAGGTGGAAGG - Intergenic
1090911421 11:131122823-131122845 TGACATCAGCAGGATGTGTATGG + Intergenic
1091011371 11:132003934-132003956 TGAAACCTGAACAATGAGGATGG - Intronic
1091231332 11:133989720-133989742 TGACTCCTGCAGAATCTAGCTGG - Intergenic
1091356775 11:134943695-134943717 GGAGACCTGCAGAATGGGGCGGG - Intergenic
1095506030 12:42899280-42899302 TGGGACCTGCAGAAAGTTGATGG - Intergenic
1095701991 12:45200209-45200231 TGACAAGTGCAGAATGTGTCTGG + Intergenic
1097373464 12:58812556-58812578 TGCCACCTCCAGACTTTGGAAGG + Exonic
1097631013 12:62062422-62062444 TCACAGCTGCAGCATGAGGAAGG - Intronic
1100167478 12:91932759-91932781 TGACATGTGAAAAATGTGGATGG - Intergenic
1100376421 12:94020048-94020070 TAACCCCTGCAGAAGCTGGATGG + Intergenic
1101407377 12:104440702-104440724 TGTCACCTGCTGAGTGGGGAGGG + Intergenic
1101958983 12:109233954-109233976 GGACACATTCAGAATGTGGATGG - Exonic
1102633099 12:114299379-114299401 TGCCTCCTGCAGGATGAGGATGG + Intergenic
1102681511 12:114693427-114693449 TTACACCTGCAAACTTTGGATGG - Intergenic
1104641677 12:130471182-130471204 TGGCACCTGCAGCCTGTGGCAGG + Intronic
1104708350 12:130966495-130966517 TGGCCACTGGAGAATGTGGATGG + Exonic
1105887382 13:24653461-24653483 GGTCTCCTGCAGAATGTGGAAGG - Intergenic
1106469900 13:30045036-30045058 TCATCCCAGCAGAATGTGGAGGG - Intergenic
1108165381 13:47687641-47687663 TAACCCTTGCACAATGTGGAGGG - Intergenic
1112730447 13:102354574-102354596 TGACACGTGCCCAATGTGGCTGG - Intronic
1114812306 14:25915488-25915510 TGACACAATCAGAATGTGGTAGG - Intergenic
1117645877 14:57852238-57852260 TGAGACCTGAGGAATGTTGAGGG + Intronic
1118174838 14:63427929-63427951 TGACCCCTGAAGACCGTGGATGG + Intronic
1119712370 14:76831399-76831421 TGAAACCTGGAGGAGGTGGAGGG + Intronic
1119996874 14:79262800-79262822 AGAAACCTGGAGAAAGTGGATGG + Intronic
1120456347 14:84735879-84735901 TAACAAATGCAGAATGTGGTGGG + Intergenic
1122136035 14:99633486-99633508 TGAGACCTGCAGAGTTGGGAGGG + Intergenic
1122298315 14:100717839-100717861 TGACACTGGCAGGATGGGGAAGG - Intergenic
1123682744 15:22774329-22774351 TCACACCTGTAAAATGGGGATGG - Intronic
1124506880 15:30284925-30284947 TGGCACCTCCAGACAGTGGATGG - Intergenic
1124686652 15:31788666-31788688 TGGCAGCTGCAGGAGGTGGAAGG + Intronic
1124736677 15:32253736-32253758 TGGCACCTCCAGACAGTGGATGG + Intergenic
1128062900 15:64746562-64746584 GGACAGCTGCAGAGTGTGGATGG + Intronic
1128111927 15:65081927-65081949 TGACACATGCTGACTGTGGGTGG - Intergenic
1128548504 15:68583153-68583175 TGGCTCCTGCTGAATGTGAAAGG + Intronic
1129170418 15:73804179-73804201 TGACATCTGCAGAATGGGTGTGG + Intergenic
1130965797 15:88696551-88696573 TCACACCTCCTGAAGGTGGATGG - Intergenic
1133709095 16:8383976-8383998 TGACACTTGCATAGTGAGGAAGG + Intergenic
1134197053 16:12167351-12167373 TGACACCTGGACAGTCTGGAGGG - Intronic
1135246178 16:20859138-20859160 TGACAGGTGCAGCATGTTGATGG + Exonic
1137522719 16:49208686-49208708 TGACACCTCAAGGATGTGCAAGG + Intergenic
1138109276 16:54310742-54310764 TGACAGCTGCACAATGTGAATGG + Intergenic
1141804518 16:86334057-86334079 TGGCACGTGGAGAATGGGGACGG - Intergenic
1142352064 16:89585098-89585120 TTTCACCTGCAGGAAGTGGAAGG - Intronic
1144758037 17:17692082-17692104 TGACTCCAGCAGGATGTGGCTGG + Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1147235219 17:39051960-39051982 TGACACCTGAAGGCGGTGGATGG + Intergenic
1148986825 17:51629677-51629699 TAACAGCTGAAGAATATGGATGG - Intergenic
1149926583 17:60707461-60707483 TGACCCTTGAACAATGTGGAGGG - Intronic
1151784985 17:76271069-76271091 TGTCTCCTGCTGAATGTGCAGGG + Exonic
1155410173 18:25535212-25535234 TGACATCTGGAGAATATGTAAGG + Intergenic
1155980830 18:32177724-32177746 TGACAGCTGCTGCATGTGGTGGG - Intronic
1156147863 18:34207986-34208008 TGACACCTGCAGAATGTGGAGGG - Intronic
1156298847 18:35817951-35817973 TGCCACCTCCAGAATCTGGGGGG - Intergenic
1159464248 18:68760060-68760082 TCACACCTGTAGAATGGAGAAGG - Intronic
1160030073 18:75250126-75250148 TGACCCCTGCAGTAGGTGGGGGG + Intronic
1160390731 18:78529880-78529902 AGACACCTGCCGAGTGTGGTGGG - Intergenic
1161998372 19:7728618-7728640 GGACACCTGAAGCATTTGGAAGG - Intergenic
1162766758 19:12924521-12924543 TGATACCTGCAGGAAGTGGGGGG + Exonic
1163072247 19:14853988-14854010 TGACAGCTGCTGAAACTGGAAGG + Intergenic
1163168225 19:15512027-15512049 TGACACCCTCAGAATGTTGTGGG - Intronic
1163578423 19:18123869-18123891 TGACACACGCAGAATGGGGCAGG - Intronic
1164413315 19:28023299-28023321 TGGCACCTGCACAATGAGAATGG - Intergenic
1164748666 19:30635136-30635158 GGACACCAGCCGAATGTGCATGG - Intronic
1165015351 19:32876414-32876436 AGACACTTGCAGCATGGGGAAGG + Intergenic
925914201 2:8593098-8593120 TGACACCTGCACAAGGTGAGAGG - Intergenic
928610651 2:32988716-32988738 GGACCTCTGCAGCATGTGGAAGG - Intronic
929667423 2:43844047-43844069 TGACACTTGCAGCATGTGAGAGG - Intronic
931543324 2:63353687-63353709 AGACACCTGTAGGAGGTGGATGG - Intronic
932336665 2:70935691-70935713 TGAGAGCTGGAGGATGTGGAGGG - Intergenic
932372479 2:71202754-71202776 TGATAACTGCAGGATGTGGATGG - Intronic
932583425 2:73007417-73007439 TGAAACCTGAAGGATGAGGAGGG - Intronic
936050288 2:109217578-109217600 TAACACATGCAGGATGTGGTAGG - Intronic
937129546 2:119497244-119497266 TGACACCTGCAGAGTGGGGGAGG - Intronic
937153775 2:119703722-119703744 AGACACCAGCAGAAGATGGAAGG + Intergenic
938191144 2:129281892-129281914 TGTCTCCTGCAGGATGTGGATGG + Intergenic
942101273 2:172586430-172586452 TGGCAGCTACAGCATGTGGAAGG - Intronic
943956748 2:194201454-194201476 TGACCACTGCAAAAAGTGGATGG - Intergenic
944015867 2:195036708-195036730 TGACACCAGCAGAAGATGGGAGG + Intergenic
945477626 2:210304108-210304130 AGAAACATGCAGAATGTGCATGG - Intronic
946263418 2:218516666-218516688 GGACACATGCAGAATGTGCAAGG - Intronic
947986967 2:234456516-234456538 TCACACCTTCAGAGAGTGGAAGG - Intergenic
948699309 2:239750420-239750442 TCACACCTGCAGAACGAGCATGG + Intergenic
1168976495 20:1969863-1969885 TAAGACCTGAAGAATGGGGAAGG - Intergenic
1169424607 20:5486052-5486074 TGACAGCTGGAGACTGGGGAGGG - Intergenic
1171423327 20:25033423-25033445 TGACAGCTGTACAAGGTGGAGGG - Intronic
1173058231 20:39636659-39636681 TGTCATCTGCAGAATGAGAATGG - Intergenic
1175297932 20:57922024-57922046 AGGCACCTTCAGGATGTGGAGGG - Intergenic
1176511439 21:7751505-7751527 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1177026933 21:15932076-15932098 TGACACCTGCAGAGTGGGGTGGG + Intergenic
1177414130 21:20772350-20772372 AGACACATGCAGAATGTGCAGGG - Intergenic
1177998932 21:28135968-28135990 TGACACGTACACAGTGTGGAAGG - Intergenic
1178083750 21:29092591-29092613 TGAGACTTCCAGAAAGTGGACGG - Intronic
1178645553 21:34382034-34382056 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1178699009 21:34818044-34818066 TGACAGCCGCAGAAAGTAGAGGG - Intronic
1178901078 21:36599181-36599203 TGACACCTTCTGAGTTTGGAGGG + Intergenic
1179426231 21:41280644-41280666 CCACATCTGCGGAATGTGGAAGG + Intronic
1179491957 21:41746571-41746593 TGACACCCACAGAATGTGGCGGG + Intronic
1180046564 21:45308978-45309000 TGACCCCTGGAGCCTGTGGATGG + Intergenic
1181799159 22:25333077-25333099 TGACACCAGCAGAAATTGGTTGG + Intergenic
1182763775 22:32743870-32743892 TGACACCTGTAGCCTCTGGAGGG - Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184507583 22:44913770-44913792 TGGCACCTGCAGACTGAGCAGGG + Intronic
1184658587 22:45954876-45954898 GCACACCTGCAAAATGAGGATGG - Intronic
1185362940 22:50419989-50420011 TGACACCTGATGAATGAGAAAGG - Intronic
949322202 3:2824052-2824074 TGACAGCTTGAGAATCTGGAGGG + Intronic
950459745 3:13114206-13114228 TTACACCTGCAGGATGCGGGTGG + Intergenic
950667774 3:14507601-14507623 AGCCACCTGCAGGAGGTGGATGG + Exonic
951285968 3:20814361-20814383 TGAGTCCTGCGGAATGTGAATGG - Intergenic
951578565 3:24138206-24138228 TGACACATGCAGAATGGAGTGGG + Intronic
952865989 3:37855511-37855533 TGAGCCCAGCTGAATGTGGAAGG - Intergenic
953534583 3:43767882-43767904 TGAGACCTGAAGGATGAGGAAGG - Intergenic
953855585 3:46497232-46497254 AGACACATGCAGTTTGTGGACGG + Intergenic
953885360 3:46711938-46711960 TGGCTCCCGCAGAAGGTGGAGGG - Intergenic
954383521 3:50232386-50232408 TAAAACATGCAGAATGTGCATGG - Intronic
954451351 3:50573343-50573365 TGCCACCTGCAGACTTTGGGAGG + Intronic
955060678 3:55489247-55489269 TGACAGCTGGAGAATGCAGACGG - Intronic
955254849 3:57320620-57320642 TCACACCTGCAGAAACTGGAAGG + Intronic
955965094 3:64381028-64381050 TCACACCTGCTCTATGTGGAAGG + Intronic
956736545 3:72243046-72243068 TGACACATGCTGAATGTGCCGGG + Intergenic
958411361 3:93820510-93820532 TGACACGTGTAAAATGTGCAAGG - Intergenic
960871613 3:122255218-122255240 TGACTTCTGCAGAATATGGTTGG + Intronic
961911018 3:130316678-130316700 TGACACCTGCAGAACAGGGAAGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963533673 3:146501762-146501784 TGAACCCTGCATAATCTGGAGGG + Intergenic
963801945 3:149684882-149684904 TGACACCATCAGAATGTAGGTGG - Intronic
965498300 3:169425962-169425984 TAACACATGGATAATGTGGAAGG + Intronic
967059498 3:185859508-185859530 TAAGACCTGGAGAATGAGGAAGG - Intergenic
968733333 4:2282154-2282176 TGGCAGCTGCAGAAGGTGGCTGG - Intronic
968920633 4:3520649-3520671 GGCCACCTGCAGACTGTGCAGGG + Intronic
969697863 4:8745299-8745321 TGACATCCGCTGAATGTTGAGGG - Intergenic
970370369 4:15399793-15399815 TGCCACTTGCAAAATTTGGAAGG + Intronic
970628936 4:17920460-17920482 TGACACCTGCTGAATGCTCAGGG + Intronic
971139963 4:23913886-23913908 TGCAGCCTGTAGAATGTGGAAGG - Intergenic
971591238 4:28472228-28472250 AGACACCTTCACAAGGTGGAAGG - Intergenic
971862149 4:32121760-32121782 GGAAACATGCAGAATGGGGAAGG - Intergenic
974073699 4:57149089-57149111 TAAGTCCTGCAGAATGTGGTTGG - Intergenic
974929024 4:68339648-68339670 TAACATCTGCAGAATGTGTTTGG + Intronic
977722361 4:100254449-100254471 TGACACCTGCAGAAGGAGGAAGG + Intergenic
979899875 4:126202284-126202306 AGACACCTGAAGAATGAGCAAGG + Intergenic
980240693 4:130170786-130170808 TAAGACCTTTAGAATGTGGAGGG - Intergenic
980970245 4:139560560-139560582 TGACAACTGCAGAAGCTGGAGGG + Intronic
982138369 4:152294365-152294387 TGACGTCTGTAGAATGAGGAGGG + Intergenic
983040905 4:162924687-162924709 TGACATCTCCAAAATGTTGAAGG - Intergenic
984247039 4:177287133-177287155 AGTCACCTGTAGAATGAGGAAGG - Intergenic
984364300 4:178778271-178778293 TGATTCCTGCAGGATGTGCAAGG + Intergenic
984651243 4:182272927-182272949 TGAGTCCTGCAGGATCTGGAAGG + Intronic
985000909 4:185481587-185481609 GGCCATCTGCAGAATGAGGAGGG - Intergenic
985960027 5:3294292-3294314 TGGTTCCTGCAGAATGAGGATGG + Intergenic
986286197 5:6360847-6360869 TGGCACCTTCAGGATGAGGATGG - Intergenic
990298452 5:54426689-54426711 TGGCCCCTTCAGCATGTGGAGGG + Intergenic
991117083 5:62966823-62966845 TGACACATGCCGAAGGTGGTCGG + Intergenic
992871193 5:81007193-81007215 GGAAACCTGCAGAAGGTGAAGGG + Intronic
992901839 5:81304389-81304411 GGAAAACTGCAGAATGTGGGAGG + Exonic
994518014 5:100794563-100794585 GGACACCTGCAGGATGAGCAAGG - Intergenic
997719647 5:136067193-136067215 TGAGACCTGAAGAATGAAGAGGG + Intergenic
999028146 5:148259250-148259272 ACACACCTGCAGGATGTGGCTGG + Intergenic
999587678 5:153108926-153108948 TGACATCTGAAGAATGGAGAAGG - Intergenic
999828008 5:155292639-155292661 TGACTCCTGCAAAATGTATAAGG + Intergenic
1001462024 5:171924624-171924646 TGGCACCGGCAGAGGGTGGAGGG - Intronic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1002390473 5:178907919-178907941 TGACAGGTGCAGCATGTTGATGG + Intronic
1003638836 6:7859470-7859492 TGTCACGGGCAGAATGTGGCTGG - Intronic
1005775903 6:29130439-29130461 TGAGATATGCAGAAAGTGGAGGG - Intergenic
1005861550 6:29906389-29906411 GGACACTTGGAGAGTGTGGAGGG + Intergenic
1006024671 6:31139301-31139323 TGACTGCTCCAGGATGTGGATGG - Exonic
1006508135 6:34504097-34504119 TGACACCAGCAGGCTGTGAATGG - Intronic
1013714703 6:112944983-112945005 TGACACCACCAGAAGCTGGAAGG + Intergenic
1013841580 6:114401996-114402018 TGACGCTTGCACAATTTGGAAGG - Intergenic
1017159461 6:151351318-151351340 TGACAGCTGCAGAAACTGCAGGG + Exonic
1019168566 6:170115620-170115642 GGAGACCTGGAGGATGTGGATGG - Intergenic
1020791112 7:12629394-12629416 TGACTCCTGCTGCCTGTGGATGG - Intronic
1021411517 7:20333998-20334020 TTACACCAGGAGAATGTTGAGGG + Intronic
1023071537 7:36439756-36439778 TGACACATGCAGACAGTGGAAGG + Intronic
1023470010 7:40507512-40507534 AGACCCCGGCTGAATGTGGATGG - Intronic
1025161210 7:56662795-56662817 TCACACCTGCAGAAGGTCCAGGG - Intergenic
1029177620 7:98675925-98675947 TGACCCCTGCAGAGTGAGAAAGG - Intergenic
1033271932 7:139939802-139939824 GGAAACCAGCAGAATGTGGAAGG + Intronic
1034107718 7:148504887-148504909 TGACAACTGTTGAATGTGGGAGG - Intergenic
1035931082 8:3780866-3780888 TGAGATTTGCAGAGTGTGGAAGG + Intronic
1037290833 8:17347902-17347924 TGCCACCTGCAGTGTGTGGGTGG + Intronic
1037305359 8:17497750-17497772 GGTCCCCTGCAGAATGTGAAGGG - Intronic
1037659382 8:20913851-20913873 TGACACTTGCTGGAAGTGGAGGG + Intergenic
1038008537 8:23455804-23455826 TTAGACCTGGAGAATTTGGAGGG - Intronic
1038214187 8:25546568-25546590 TGTCACCAGTAGAAAGTGGATGG - Intergenic
1038879354 8:31590816-31590838 TGATACCCCCAAAATGTGGAAGG + Intergenic
1040563653 8:48546570-48546592 TGAGACCTGAATAATGTGGAAGG - Intergenic
1044249559 8:89989896-89989918 TGACACCTGGGTAAAGTGGAAGG - Intronic
1045031240 8:98138456-98138478 TGAAATCTGAAGAATGAGGAAGG - Intronic
1045434005 8:102141282-102141304 TCACAACTTCAGTATGTGGAGGG + Intergenic
1045594351 8:103635634-103635656 AGACACCTGCAGGAAGTGGCTGG + Intronic
1045902875 8:107306167-107306189 AGACACTAGCAGAATGTGGAAGG + Intronic
1045959943 8:107955070-107955092 TGAAAGCTGCTGGATGTGGAAGG + Intronic
1049598062 8:143493474-143493496 CCACACCTGGAGAAGGTGGAAGG + Intronic
1050674298 9:8034626-8034648 TGGCACCTGGGGAATATGGAAGG - Intergenic
1051825231 9:21211752-21211774 TGACTCCTGAAGAATAGGGATGG - Intronic
1053052627 9:34974492-34974514 AGACAGCTGCAGAATGTGGGAGG - Intronic
1053265336 9:36708939-36708961 ACACACCTGCAGAATGCAGATGG - Intergenic
1054976868 9:71157190-71157212 TAACACCTACACAATGTTGAAGG + Intronic
1055465684 9:76563604-76563626 TCACACCTGCATGGTGTGGAAGG + Intergenic
1055982098 9:82014205-82014227 TGACATCTGGAGAGTGTGGAGGG + Intergenic
1056990154 9:91403167-91403189 AGGAACCTGCAGAATCTGGAAGG - Intergenic
1057504085 9:95618332-95618354 TGTCACCTGGAAAATGTGGAGGG - Intergenic
1057858000 9:98617048-98617070 TTATACCTTCAGAATGTGAATGG - Intronic
1061016702 9:127985198-127985220 TCACACCTGGAGAAAGTGGGAGG + Intergenic
1061394668 9:130337456-130337478 TGACACCTGTTGACTGTGGGTGG - Intronic
1062135875 9:134927981-134928003 TGATACCAGGAGAATGTGTATGG + Intergenic
1186522808 X:10220939-10220961 TCAGCCCTGAAGAATGTGGAGGG + Intronic
1186596309 X:10985357-10985379 AGAGACTTGAAGAATGTGGAGGG - Intergenic
1186789759 X:12985525-12985547 TCTCACCTGCCTAATGTGGAAGG + Intergenic
1186823130 X:13312044-13312066 GGACACCTGCAAAATGTCCATGG - Intergenic
1186824764 X:13328574-13328596 GGACACCTGCAAAATGTCTACGG - Intergenic
1187363210 X:18646700-18646722 TGATACCTCCAGGGTGTGGATGG - Intronic
1190712246 X:53079276-53079298 TGACCCATACAGAATGGGGAGGG + Exonic
1192465072 X:71348964-71348986 TGACACATGGAGAATGTGTTAGG + Intergenic
1192723337 X:73723535-73723557 ACACACCTGTAGAATGTGGCTGG + Intergenic
1196051788 X:111313273-111313295 TCACACATGCAGAATGAGGTAGG - Intronic
1197750970 X:129963336-129963358 TGACTCCTGCAGAGTGAGGAGGG - Intergenic
1198340282 X:135707391-135707413 TTACACCTGAAGATAGTGGATGG - Intergenic
1198774230 X:140162594-140162616 TGTCAACTGCTGGATGTGGAGGG - Intergenic
1199353363 X:146831661-146831683 TGACAACTGGAGAATGAGAAGGG - Intergenic