ID: 1156160292

View in Genome Browser
Species Human (GRCh38)
Location 18:34350938-34350960
Sequence GGGCAGAGGCAGCAGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156160292_1156160306 7 Left 1156160292 18:34350938-34350960 CCAGCCCCCTGCTGCCTCTGCCC No data
Right 1156160306 18:34350968-34350990 CTTTGGGCTCCCCTCTGGAAGGG No data
1156160292_1156160312 19 Left 1156160292 18:34350938-34350960 CCAGCCCCCTGCTGCCTCTGCCC No data
Right 1156160312 18:34350980-34351002 CTCTGGAAGGGGAAGCTAATGGG No data
1156160292_1156160307 8 Left 1156160292 18:34350938-34350960 CCAGCCCCCTGCTGCCTCTGCCC No data
Right 1156160307 18:34350969-34350991 TTTGGGCTCCCCTCTGGAAGGGG No data
1156160292_1156160299 -9 Left 1156160292 18:34350938-34350960 CCAGCCCCCTGCTGCCTCTGCCC No data
Right 1156160299 18:34350952-34350974 CCTCTGCCCCTCCTGACTTTGGG No data
1156160292_1156160304 2 Left 1156160292 18:34350938-34350960 CCAGCCCCCTGCTGCCTCTGCCC No data
Right 1156160304 18:34350963-34350985 CCTGACTTTGGGCTCCCCTCTGG No data
1156160292_1156160311 18 Left 1156160292 18:34350938-34350960 CCAGCCCCCTGCTGCCTCTGCCC No data
Right 1156160311 18:34350979-34351001 CCTCTGGAAGGGGAAGCTAATGG No data
1156160292_1156160314 28 Left 1156160292 18:34350938-34350960 CCAGCCCCCTGCTGCCTCTGCCC No data
Right 1156160314 18:34350989-34351011 GGGAAGCTAATGGGAGGTTGAGG No data
1156160292_1156160315 29 Left 1156160292 18:34350938-34350960 CCAGCCCCCTGCTGCCTCTGCCC No data
Right 1156160315 18:34350990-34351012 GGAAGCTAATGGGAGGTTGAGGG No data
1156160292_1156160305 6 Left 1156160292 18:34350938-34350960 CCAGCCCCCTGCTGCCTCTGCCC No data
Right 1156160305 18:34350967-34350989 ACTTTGGGCTCCCCTCTGGAAGG No data
1156160292_1156160297 -10 Left 1156160292 18:34350938-34350960 CCAGCCCCCTGCTGCCTCTGCCC No data
Right 1156160297 18:34350951-34350973 GCCTCTGCCCCTCCTGACTTTGG No data
1156160292_1156160313 22 Left 1156160292 18:34350938-34350960 CCAGCCCCCTGCTGCCTCTGCCC No data
Right 1156160313 18:34350983-34351005 TGGAAGGGGAAGCTAATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156160292 Original CRISPR GGGCAGAGGCAGCAGGGGGC TGG (reversed) Intergenic
No off target data available for this crispr