ID: 1156160293

View in Genome Browser
Species Human (GRCh38)
Location 18:34350942-34350964
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156160293_1156160312 15 Left 1156160293 18:34350942-34350964 CCCCCTGCTGCCTCTGCCCCTCC No data
Right 1156160312 18:34350980-34351002 CTCTGGAAGGGGAAGCTAATGGG No data
1156160293_1156160316 28 Left 1156160293 18:34350942-34350964 CCCCCTGCTGCCTCTGCCCCTCC No data
Right 1156160316 18:34350993-34351015 AGCTAATGGGAGGTTGAGGGTGG No data
1156160293_1156160304 -2 Left 1156160293 18:34350942-34350964 CCCCCTGCTGCCTCTGCCCCTCC No data
Right 1156160304 18:34350963-34350985 CCTGACTTTGGGCTCCCCTCTGG No data
1156160293_1156160314 24 Left 1156160293 18:34350942-34350964 CCCCCTGCTGCCTCTGCCCCTCC No data
Right 1156160314 18:34350989-34351011 GGGAAGCTAATGGGAGGTTGAGG No data
1156160293_1156160306 3 Left 1156160293 18:34350942-34350964 CCCCCTGCTGCCTCTGCCCCTCC No data
Right 1156160306 18:34350968-34350990 CTTTGGGCTCCCCTCTGGAAGGG No data
1156160293_1156160315 25 Left 1156160293 18:34350942-34350964 CCCCCTGCTGCCTCTGCCCCTCC No data
Right 1156160315 18:34350990-34351012 GGAAGCTAATGGGAGGTTGAGGG No data
1156160293_1156160313 18 Left 1156160293 18:34350942-34350964 CCCCCTGCTGCCTCTGCCCCTCC No data
Right 1156160313 18:34350983-34351005 TGGAAGGGGAAGCTAATGGGAGG No data
1156160293_1156160307 4 Left 1156160293 18:34350942-34350964 CCCCCTGCTGCCTCTGCCCCTCC No data
Right 1156160307 18:34350969-34350991 TTTGGGCTCCCCTCTGGAAGGGG No data
1156160293_1156160305 2 Left 1156160293 18:34350942-34350964 CCCCCTGCTGCCTCTGCCCCTCC No data
Right 1156160305 18:34350967-34350989 ACTTTGGGCTCCCCTCTGGAAGG No data
1156160293_1156160311 14 Left 1156160293 18:34350942-34350964 CCCCCTGCTGCCTCTGCCCCTCC No data
Right 1156160311 18:34350979-34351001 CCTCTGGAAGGGGAAGCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156160293 Original CRISPR GGAGGGGCAGAGGCAGCAGG GGG (reversed) Intergenic
No off target data available for this crispr