ID: 1156160297

View in Genome Browser
Species Human (GRCh38)
Location 18:34350951-34350973
Sequence GCCTCTGCCCCTCCTGACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156160288_1156160297 30 Left 1156160288 18:34350898-34350920 CCCAGCTGGGTGTGCACATGCTC No data
Right 1156160297 18:34350951-34350973 GCCTCTGCCCCTCCTGACTTTGG No data
1156160289_1156160297 29 Left 1156160289 18:34350899-34350921 CCAGCTGGGTGTGCACATGCTCA No data
Right 1156160297 18:34350951-34350973 GCCTCTGCCCCTCCTGACTTTGG No data
1156160292_1156160297 -10 Left 1156160292 18:34350938-34350960 CCAGCCCCCTGCTGCCTCTGCCC No data
Right 1156160297 18:34350951-34350973 GCCTCTGCCCCTCCTGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156160297 Original CRISPR GCCTCTGCCCCTCCTGACTT TGG Intergenic
No off target data available for this crispr