ID: 1156160298

View in Genome Browser
Species Human (GRCh38)
Location 18:34350952-34350974
Sequence CCCAAAGTCAGGAGGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156160298_1156160317 22 Left 1156160298 18:34350952-34350974 CCTCTGCCCCTCCTGACTTTGGG No data
Right 1156160317 18:34350997-34351019 AATGGGAGGTTGAGGGTGGCTGG No data
1156160298_1156160318 23 Left 1156160298 18:34350952-34350974 CCTCTGCCCCTCCTGACTTTGGG No data
Right 1156160318 18:34350998-34351020 ATGGGAGGTTGAGGGTGGCTGGG No data
1156160298_1156160316 18 Left 1156160298 18:34350952-34350974 CCTCTGCCCCTCCTGACTTTGGG No data
Right 1156160316 18:34350993-34351015 AGCTAATGGGAGGTTGAGGGTGG No data
1156160298_1156160315 15 Left 1156160298 18:34350952-34350974 CCTCTGCCCCTCCTGACTTTGGG No data
Right 1156160315 18:34350990-34351012 GGAAGCTAATGGGAGGTTGAGGG No data
1156160298_1156160312 5 Left 1156160298 18:34350952-34350974 CCTCTGCCCCTCCTGACTTTGGG No data
Right 1156160312 18:34350980-34351002 CTCTGGAAGGGGAAGCTAATGGG No data
1156160298_1156160313 8 Left 1156160298 18:34350952-34350974 CCTCTGCCCCTCCTGACTTTGGG No data
Right 1156160313 18:34350983-34351005 TGGAAGGGGAAGCTAATGGGAGG No data
1156160298_1156160314 14 Left 1156160298 18:34350952-34350974 CCTCTGCCCCTCCTGACTTTGGG No data
Right 1156160314 18:34350989-34351011 GGGAAGCTAATGGGAGGTTGAGG No data
1156160298_1156160319 29 Left 1156160298 18:34350952-34350974 CCTCTGCCCCTCCTGACTTTGGG No data
Right 1156160319 18:34351004-34351026 GGTTGAGGGTGGCTGGGCACTGG No data
1156160298_1156160305 -8 Left 1156160298 18:34350952-34350974 CCTCTGCCCCTCCTGACTTTGGG No data
Right 1156160305 18:34350967-34350989 ACTTTGGGCTCCCCTCTGGAAGG No data
1156160298_1156160306 -7 Left 1156160298 18:34350952-34350974 CCTCTGCCCCTCCTGACTTTGGG No data
Right 1156160306 18:34350968-34350990 CTTTGGGCTCCCCTCTGGAAGGG No data
1156160298_1156160311 4 Left 1156160298 18:34350952-34350974 CCTCTGCCCCTCCTGACTTTGGG No data
Right 1156160311 18:34350979-34351001 CCTCTGGAAGGGGAAGCTAATGG No data
1156160298_1156160307 -6 Left 1156160298 18:34350952-34350974 CCTCTGCCCCTCCTGACTTTGGG No data
Right 1156160307 18:34350969-34350991 TTTGGGCTCCCCTCTGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156160298 Original CRISPR CCCAAAGTCAGGAGGGGCAG AGG (reversed) Intergenic
No off target data available for this crispr